ID: 1168970427

View in Genome Browser
Species Human (GRCh38)
Location 20:1927102-1927124
Sequence CTGGGTTAACGCTTGCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 73}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168970427_1168970431 25 Left 1168970427 20:1927102-1927124 CCAGGCAGCAAGCGTTAACCCAG 0: 1
1: 0
2: 1
3: 2
4: 73
Right 1168970431 20:1927150-1927172 GCCTCCAGCCTATTAAAGTGCGG 0: 1
1: 0
2: 0
3: 4
4: 91
1168970427_1168970430 0 Left 1168970427 20:1927102-1927124 CCAGGCAGCAAGCGTTAACCCAG 0: 1
1: 0
2: 1
3: 2
4: 73
Right 1168970430 20:1927125-1927147 CAGCAAGAATTCTTGCACTGTGG 0: 1
1: 0
2: 0
3: 14
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168970427 Original CRISPR CTGGGTTAACGCTTGCTGCC TGG (reversed) Intronic
901590678 1:10339194-10339216 GTGGGAAAACGCTTGCTGTCTGG + Intronic
904821098 1:33245023-33245045 CTGGGTGAACTCAGGCTGCCAGG + Intergenic
905307165 1:37027804-37027826 CTGGGATAATGGTGGCTGCCAGG - Intronic
908397965 1:63743616-63743638 CTGGCTTAACTCTTGCTGCCTGG - Intergenic
909823049 1:80090340-80090362 CTGAGTTAATGCTTGCCTCCGGG + Intergenic
912505631 1:110153815-110153837 CTGAGTTATCACTTGCTCCCAGG + Intronic
914193494 1:145431260-145431282 CTGGGTGGACGCTGCCTGCCCGG + Intergenic
914352142 1:146849695-146849717 CTGGGTTACCACTTGGTGCATGG - Intergenic
914474823 1:148014150-148014172 CTGGGTGGACGCTGCCTGCCCGG + Intergenic
920761502 1:208787431-208787453 CAGGGTGACAGCTTGCTGCCAGG + Intergenic
1065186148 10:23172741-23172763 CTGGATTAATGCTTGGTGCCAGG + Intergenic
1069102762 10:64343756-64343778 CTGAATTAATGCTTCCTGCCAGG + Intergenic
1069915273 10:71783270-71783292 CTGGGCTCACGCTTGCTCACTGG + Intronic
1074448207 10:113537787-113537809 CTGGGTGGGGGCTTGCTGCCTGG - Intergenic
1076512760 10:131024083-131024105 CTGGGTTAAGCACTGCTGCCTGG + Intergenic
1079355989 11:19730646-19730668 CTGGGTTCACGCTGCCTTCCTGG - Intronic
1085414849 11:76313149-76313171 CTGGGTAAATGTTTGCTGGCTGG + Intergenic
1088089538 11:106022072-106022094 TTGGCGCAACGCTTGCTGCCGGG - Exonic
1089009383 11:115120261-115120283 CTGGGTTTAGGCTAGCTGCAGGG + Intergenic
1089578943 11:119469458-119469480 CTTGGTTAAGGCTTCCTTCCGGG + Intergenic
1095140239 12:38653818-38653840 CTGAGTTAATGCTTTGTGCCTGG - Exonic
1103028688 12:117594707-117594729 CTGGTTTAACTCTTGTTGCGGGG - Intronic
1106854108 13:33829007-33829029 CTTGGGTAAAGCTTGTTGCCTGG + Intronic
1112276563 13:98026719-98026741 CTGGGGTCACACTTCCTGCCTGG + Intergenic
1112356113 13:98676021-98676043 CTGGGTGAACGCGTGCTTTCGGG - Intergenic
1116101821 14:40447966-40447988 CTTGATTAAAGCTTGATGCCTGG - Intergenic
1117450354 14:55844118-55844140 GTGAGTTCACGCTTCCTGCCTGG - Intergenic
1118603532 14:67487060-67487082 CTGGGTTAACCTTTGTTGGCTGG + Exonic
1128386519 15:67153169-67153191 CTGGGTAAACGCTTGCTCTGAGG + Intronic
1134509883 16:14837486-14837508 CTGGGTTAACACTTCGTGTCTGG + Intronic
1134697531 16:16235985-16236007 CTGGGTTAACACTTCGTGTCTGG + Intronic
1134974312 16:18558690-18558712 CTGGGTTAACACTTCGTGTCTGG - Intronic
1137713841 16:50585601-50585623 CTGGGTAAACGCTTGGCGGCTGG - Intronic
1138023223 16:53503129-53503151 CTGGGGTGAGGCTTACTGCCCGG - Exonic
1138816664 16:60210676-60210698 CTGTCTTAACTCTTGTTGCCTGG + Intergenic
1139062703 16:63274059-63274081 ATTGGTTAACTGTTGCTGCCAGG + Intergenic
1139981888 16:70865837-70865859 CTGGGTTACCACTTGGTGCATGG + Intronic
1143416994 17:6757497-6757519 CTAGGCTCACGCTTCCTGCCAGG - Intronic
1152587915 17:81197348-81197370 CTGGGTGAACACTAGCGGCCAGG - Intronic
1158632094 18:59124172-59124194 CTGGGTTTACTCATGCAGCCTGG + Intergenic
1160244279 18:77144741-77144763 CTGGGAGAAAGCTTGTTGCCAGG - Intergenic
1160872783 19:1284712-1284734 CTGGGTTCACGGTCCCTGCCAGG + Intergenic
1161467508 19:4439918-4439940 CAGGGTCAACCCATGCTGCCTGG + Intronic
1161848471 19:6725886-6725908 CTGGGTTAAGGATTGTTTCCTGG - Intronic
1168640679 19:58029419-58029441 CTGGGTTAACACCTCCTGCCTGG + Intergenic
930177288 2:48314466-48314488 CTGGGTTCCGGCTGGCTGCCTGG - Intergenic
937574019 2:123397257-123397279 CTGGGTTCACTCTTCCTGTCAGG + Intergenic
945009481 2:205446076-205446098 CTGTTTTCACCCTTGCTGCCTGG - Intronic
945206808 2:207341392-207341414 CTGGGTTAGCACTAGCAGCCAGG + Intergenic
1168970427 20:1927102-1927124 CTGGGTTAACGCTTGCTGCCTGG - Intronic
1173486122 20:43442489-43442511 CTTGGTTGAAGCTTGCTTCCAGG - Intergenic
1178110102 21:29361310-29361332 TTGGGTTAAGGCTTGCAGCTGGG + Intronic
1179434013 21:41347383-41347405 CTGGGTTTAGGCTTTCTGTCCGG - Intronic
950670074 3:14520610-14520632 CTGATTTAATCCTTGCTGCCTGG + Intronic
952408682 3:33027385-33027407 CTCGGTTCATGCTTCCTGCCTGG - Intronic
954859481 3:53675526-53675548 CTGGGGCAACGGTTCCTGCCTGG - Intronic
957470625 3:80653778-80653800 CTGGGTGAAAGTTTGCTGCAGGG + Intergenic
961719023 3:128879854-128879876 CTGGGCGAACCCTTGCTGTCTGG + Intronic
963093648 3:141511533-141511555 TTGGGTTAAATCATGCTGCCAGG + Intronic
964741853 3:159974870-159974892 TTGGGTTAAAGCCTGCTGTCTGG + Intergenic
988502941 5:31798763-31798785 CTGGGTTTGTGCTTGGTGCCTGG + Intronic
988520027 5:31937469-31937491 TTGGGTTACTGCTTACTGCCTGG + Intronic
988959245 5:36353172-36353194 CTAGGTTAACGCTTAATTCCTGG - Intergenic
1000115907 5:158153002-158153024 TTGGCTTAATGCTTGGTGCCTGG - Intergenic
1007653405 6:43437292-43437314 CTGGGTCAACCCTGGCTGGCAGG + Intronic
1014031842 6:116714926-116714948 CTGTCTTAAAGGTTGCTGCCAGG + Intronic
1019536590 7:1532576-1532598 CTCGGTAAACGCTGGCTCCCGGG - Intronic
1019568649 7:1697454-1697476 CTGGGTTGACCCTGCCTGCCAGG + Intronic
1020082763 7:5295647-5295669 CTGGGCTTCCGCTTCCTGCCTGG - Intronic
1025211505 7:57021530-57021552 CTGGGCTTCCGCTTCCTGCCTGG + Intergenic
1025660450 7:63555317-63555339 CTGGGCTTCCGCTTCCTGCCTGG - Intergenic
1032288715 7:130566673-130566695 GAGGGTTATGGCTTGCTGCCCGG + Intronic
1035248584 7:157581484-157581506 AGGGGTTAAAGCCTGCTGCCAGG + Intronic
1037620808 8:20561931-20561953 CTGGGCTAAAGCTTCTTGCCTGG + Intergenic
1049473618 8:142787061-142787083 CTGGGCTCAGGGTTGCTGCCGGG + Intergenic
1061245525 9:129399575-129399597 CTGGGTCCCCGCTGGCTGCCTGG - Intergenic
1196859938 X:120017031-120017053 CTGGGGGATCGCTTGATGCCAGG + Intergenic