ID: 1168970993

View in Genome Browser
Species Human (GRCh38)
Location 20:1930533-1930555
Sequence GTGGCTACACAGCCCCATCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 143}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168970989_1168970993 -4 Left 1168970989 20:1930514-1930536 CCTAAAATGCTGCTTCCCAGTGG 0: 1
1: 0
2: 1
3: 15
4: 193
Right 1168970993 20:1930533-1930555 GTGGCTACACAGCCCCATCTAGG 0: 1
1: 0
2: 1
3: 13
4: 143
1168970986_1168970993 17 Left 1168970986 20:1930493-1930515 CCACTCTGCCTTCTCTGAATCCC 0: 1
1: 1
2: 9
3: 63
4: 659
Right 1168970993 20:1930533-1930555 GTGGCTACACAGCCCCATCTAGG 0: 1
1: 0
2: 1
3: 13
4: 143
1168970985_1168970993 18 Left 1168970985 20:1930492-1930514 CCCACTCTGCCTTCTCTGAATCC 0: 1
1: 0
2: 6
3: 45
4: 487
Right 1168970993 20:1930533-1930555 GTGGCTACACAGCCCCATCTAGG 0: 1
1: 0
2: 1
3: 13
4: 143
1168970988_1168970993 -3 Left 1168970988 20:1930513-1930535 CCCTAAAATGCTGCTTCCCAGTG 0: 1
1: 1
2: 0
3: 22
4: 148
Right 1168970993 20:1930533-1930555 GTGGCTACACAGCCCCATCTAGG 0: 1
1: 0
2: 1
3: 13
4: 143
1168970987_1168970993 9 Left 1168970987 20:1930501-1930523 CCTTCTCTGAATCCCTAAAATGC 0: 1
1: 0
2: 1
3: 35
4: 270
Right 1168970993 20:1930533-1930555 GTGGCTACACAGCCCCATCTAGG 0: 1
1: 0
2: 1
3: 13
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168970993 Original CRISPR GTGGCTACACAGCCCCATCT AGG Intronic
902537112 1:17125935-17125957 GTGGCGCCAGATCCCCATCTTGG + Intergenic
902990381 1:20183578-20183600 GAGGGTGCACAGCACCATCTTGG + Intergenic
904811543 1:33166166-33166188 GCAGCTAGACAGTCCCATCTGGG - Intronic
905974779 1:42166206-42166228 TTGGCTACACACACCCATCAGGG - Intergenic
907402907 1:54236013-54236035 GTGGCTGGCTAGCCCCATCTAGG + Intronic
908051899 1:60242283-60242305 GTGTCTGCACAGCCCCATAGTGG + Intergenic
909642289 1:77882534-77882556 GTGGCAACACTTCCACATCTAGG - Intergenic
921884937 1:220296206-220296228 GTGGCTACACATTTCCATTTTGG + Intergenic
921950764 1:220927522-220927544 GTGCCTACACAGTCCCCACTGGG - Intergenic
923722896 1:236482475-236482497 GAGGCCACAGAGCCCCACCTTGG + Exonic
1063506130 10:6601400-6601422 GCAACTAGACAGCCCCATCTGGG + Intergenic
1066184717 10:32998112-32998134 GTGGCAACAAGGCTCCATCTTGG - Intronic
1069308567 10:67004110-67004132 ATGGCTCCACAGCCAGATCTTGG - Intronic
1069372271 10:67760839-67760861 GTAACTAGACAGTCCCATCTGGG - Intergenic
1074852469 10:117449703-117449725 GCAGCTCCACAGCGCCATCTGGG + Intergenic
1075656721 10:124166707-124166729 TTGGCTACACAGGCCCACCTTGG + Intergenic
1076606843 10:131694865-131694887 GTGGCCACACAGCTCCTTCTGGG - Intergenic
1078920422 11:15825610-15825632 GTGGGTCCACAGGGCCATCTTGG + Intergenic
1079664815 11:23092237-23092259 GCAACTACACAGTCCCATCTGGG + Intergenic
1083294283 11:61706887-61706909 CTGGCTTGACAGCCCCAGCTGGG + Intronic
1083416038 11:62526430-62526452 GCAGCTTCACATCCCCATCTGGG + Exonic
1099317805 12:81106365-81106387 GTAACTAGACAGTCCCATCTTGG - Intronic
1099689658 12:85936952-85936974 ATGACTATACAGCCCCAACTAGG - Intergenic
1102627345 12:114245723-114245745 GTTGCTACACTGCCCCTTGTTGG - Intergenic
1107453913 13:40536986-40537008 ATGGCTAGACAGCCCCTGCTGGG - Intergenic
1118535907 14:66763988-66764010 GCAGCTAGACAGTCCCATCTGGG - Intronic
1119023764 14:71136688-71136710 GTGGCCCCACAGCAGCATCTAGG + Intergenic
1119454445 14:74742670-74742692 GTAACTAGACAGTCCCATCTGGG + Intergenic
1121438938 14:93936725-93936747 GAGGCTGCACAGTCCCACCTGGG + Intronic
1122083333 14:99282378-99282400 GTGGCAACAAGGCACCATCTTGG - Intergenic
1122305477 14:100763426-100763448 GCAGCTAGACAGTCCCATCTGGG + Intergenic
1122412383 14:101532331-101532353 GTGTCTACACAGCCCTCTCTGGG - Intergenic
1124132261 15:27001346-27001368 GTGGCTCCACTGGCCCACCTGGG - Intronic
1124132835 15:27004953-27004975 GTGGCTCCATTGGCCCATCTGGG + Intronic
1124553996 15:30708918-30708940 GTGGGCACCCACCCCCATCTGGG + Intronic
1124677251 15:31696753-31696775 GTGGGCACCCACCCCCATCTGGG - Intronic
1124871986 15:33552645-33552667 GTGGGAACACAGCCATATCTTGG - Intronic
1125135210 15:36333254-36333276 GCAGCTAGACAGTCCCATCTTGG - Intergenic
1125740063 15:41956275-41956297 GCGGCAACACGGCCCCTTCTCGG + Intronic
1128555762 15:68630728-68630750 GTGGCTCCACAGTGCCATCAAGG + Intronic
1129335775 15:74851287-74851309 GTGACTTGAGAGCCCCATCTTGG - Intronic
1129870332 15:78936124-78936146 GTCTCTACACAGCCCCAGCAGGG + Intronic
1130359063 15:83164042-83164064 GAGGCTTCACAGCGCCCTCTGGG + Exonic
1131403172 15:92142717-92142739 GTGCCTGCACAGCCCCATCCGGG - Intronic
1133650368 16:7807016-7807038 GCAGCTAGACAGTCCCATCTGGG - Intergenic
1136342113 16:29650949-29650971 GTTGCTACACTGCTACATCTTGG - Intergenic
1140047902 16:71454656-71454678 GAGGCTGCACAGCCCCTTGTTGG - Intronic
1142241955 16:88951585-88951607 GTGGCTTCTCAGCTCCAGCTCGG + Intronic
1143386135 17:6531727-6531749 GTGGGTTCACAGCCCCAGCAAGG - Intronic
1143517370 17:7426632-7426654 GTGGCCCCACAGCCCCACATTGG - Exonic
1146590779 17:34126456-34126478 GAGGCTAAACAGCCCCATGCAGG - Intronic
1148887661 17:50785503-50785525 GTTGGTACTCAGCCCCTTCTGGG + Intergenic
1151215156 17:72572048-72572070 CTTTCTACTCAGCCCCATCTTGG + Intergenic
1151385625 17:73753600-73753622 GTGCCCACCCAGCCTCATCTAGG - Intergenic
1152329992 17:79667202-79667224 GAGGGTCCACATCCCCATCTTGG + Intergenic
1153186596 18:2493033-2493055 GTGGGTACACAGCCCCCTTCAGG - Intergenic
1154253634 18:12765151-12765173 GTGCCTACCCATCCCCTTCTTGG - Intergenic
1157795774 18:50573551-50573573 GTAACTAGACAGTCCCATCTGGG - Intronic
1158277216 18:55781137-55781159 GTGGAGACCCTGCCCCATCTGGG - Intergenic
1158763100 18:60414128-60414150 GCAGCTACACAGTTCCATCTAGG + Intergenic
1159306531 18:66650472-66650494 GTAGCAACACGGCACCATCTTGG + Intergenic
1159994924 18:74955231-74955253 GTGTTTACACAGGCACATCTCGG + Intronic
1161343047 19:3753140-3753162 GTGGAGAGACAGCCGCATCTTGG + Intronic
1161966278 19:7550903-7550925 GGGGCTGTACTGCCCCATCTAGG - Intronic
1164881749 19:31738726-31738748 GCTCCTACCCAGCCCCATCTGGG + Intergenic
1166000212 19:39873169-39873191 AAGGCAACACAGCCCCATCTAGG - Intronic
1166222990 19:41377434-41377456 CCTGCCACACAGCCCCATCTAGG - Intronic
925900857 2:8508639-8508661 GAGGCCACGCAGCCCCAGCTGGG + Intergenic
926647325 2:15303810-15303832 CTGGCTCCACAGCCACATTTTGG - Intronic
927822634 2:26281784-26281806 GTGGCTACACAGTCTCTTCAGGG + Intronic
929119127 2:38469376-38469398 TTGGTTTCTCAGCCCCATCTTGG + Intergenic
930001194 2:46862606-46862628 ATGGGGACACTGCCCCATCTGGG - Intergenic
930566630 2:53028683-53028705 TTGGCTACACAGCCCTTTTTGGG - Intergenic
931756936 2:65382958-65382980 GTGGCATCCCAGCCCCACCTCGG + Intronic
933006146 2:76997976-76997998 GTAACTAGACAGTCCCATCTTGG - Intronic
933245580 2:79971085-79971107 GAGGCGAGACAGCCCCATTTTGG + Intronic
935192864 2:100792669-100792691 GTGGTTGCACAGCTCCATCTTGG + Intergenic
937311514 2:120905982-120906004 GGGACTGCACAGCCCCATCTGGG - Intronic
937928069 2:127183041-127183063 GCGGCTCCACAGCCCCTTCCCGG - Intergenic
940106622 2:150108387-150108409 GTGTCTACACAGCCCAACTTAGG - Intergenic
940612332 2:156006934-156006956 CTGGGTCCACAGCCCCAGCTTGG + Intergenic
943566372 2:189521741-189521763 GTGGCTATACAGCCTCTTCGAGG + Intergenic
944290771 2:198001947-198001969 GCAACTACACAGTCCCATCTGGG - Intronic
944505003 2:200402104-200402126 TTTTCTACACTGCCCCATCTTGG + Intronic
947450391 2:230203038-230203060 GTGGCCACACAGTCTCGTCTAGG + Intronic
948506816 2:238434008-238434030 GTGGCGGCCCTGCCCCATCTTGG + Intronic
1168970993 20:1930533-1930555 GTGGCTACACAGCCCCATCTAGG + Intronic
1172944618 20:38677616-38677638 ATGCCTCCAGAGCCCCATCTGGG + Intergenic
1174902035 20:54510255-54510277 GTGGATAAACAGCCCCTTCTAGG - Intronic
1175304683 20:57967681-57967703 GTGGCTACACAGGCTTATCTCGG + Intergenic
1176021655 20:62965308-62965330 CTGTCTAAACAGCCCCTTCTGGG - Intronic
1184879429 22:47295597-47295619 GTGGCTACACACCTGCATTTTGG + Intergenic
949956612 3:9274478-9274500 GTGGCCCCACAGCAGCATCTAGG + Intronic
955204051 3:56879053-56879075 GCAACTACACAGTCCCATCTGGG - Intronic
956552060 3:70472323-70472345 GGAACTAAACAGCCCCATCTGGG - Intergenic
959530363 3:107429495-107429517 TGGGCAACACAGCCCCATCCCGG - Intergenic
960013274 3:112856605-112856627 GAGGCAAGACAGACCCATCTAGG + Intergenic
960662103 3:120071630-120071652 GTGACTAGACAGTCCCATCTGGG - Intronic
961550386 3:127667541-127667563 GTCCCTGCCCAGCCCCATCTAGG - Intronic
963044011 3:141089271-141089293 GTGGCTGCAAATCCCCATCCTGG - Intronic
964590822 3:158360824-158360846 CTGGGTCCACAGCCCCAACTTGG + Intronic
968089310 3:195890218-195890240 GAGGCTGCACAGCCCCCTATGGG + Intronic
968500199 4:946327-946349 GTGGCCAGAGAGCCCCATGTTGG - Intronic
970760249 4:19476817-19476839 GTGACTAGACAGTTCCATCTGGG - Intergenic
971125451 4:23749091-23749113 GTGCATACACAGCCACATGTTGG + Intergenic
972305138 4:37823623-37823645 GAGGCTGCACAGACTCATCTGGG + Intergenic
977323901 4:95550614-95550636 CTGCCTGCACAGCCCCATCTAGG + Intergenic
979445830 4:120809965-120809987 GTAGCTAGACAGTCCCATCTGGG - Intronic
986370826 5:7078353-7078375 CTGGCTACACAGGCCCCTTTTGG - Intergenic
987284782 5:16445446-16445468 GTGGTTACACAGCAGAATCTGGG - Intergenic
987322297 5:16781819-16781841 CTGTCTTCACAGCCCCATCATGG - Exonic
988732273 5:33984343-33984365 GTGGTTCCTCAGCCCCATCCTGG - Exonic
995709577 5:115021309-115021331 GCAACTAGACAGCCCCATCTGGG + Intergenic
998575610 5:143312258-143312280 TTGGCCACACAGACCAATCTTGG - Intronic
1001206802 5:169771074-169771096 GTGGCTACACAGGTCCACTTCGG - Intronic
1004632702 6:17437033-17437055 GTAACTAGACAGTCCCATCTGGG - Intronic
1006154037 6:32004553-32004575 GTGGCTATCCAGCCCCTTCCTGG + Intergenic
1006160346 6:32037290-32037312 GTGGCTATCCAGCCCCTTCCTGG + Intergenic
1006406617 6:33849283-33849305 ATGGATGCACAGCCCCAGCTTGG - Intergenic
1018713837 6:166516464-166516486 GTGGGGACACTGCCCCTTCTAGG + Intronic
1019322885 7:423629-423651 GTGGCCACACAGCCCCCAATGGG - Intergenic
1019550439 7:1599644-1599666 ATGGCTGCACAGCCCCTTCGAGG - Intergenic
1020187668 7:5971262-5971284 GCAACTAGACAGCCCCATCTGGG + Intergenic
1020295249 7:6753508-6753530 GCAACTAGACAGCCCCATCTGGG - Intergenic
1021131857 7:16921334-16921356 GTGACTACAGGGCCCCACCTGGG + Intergenic
1024577574 7:50777183-50777205 GTGGCAACAAGGCACCATCTTGG - Intronic
1025937660 7:66050066-66050088 GCAACTAGACAGCCCCATCTGGG + Intergenic
1027225723 7:76242672-76242694 GCAGCTAGACAGTCCCATCTGGG + Intronic
1027662743 7:81006532-81006554 CTGGCTACACAGGTCCAACTCGG + Intergenic
1029683193 7:102126888-102126910 GCAACTACACAGTCCCATCTGGG + Intronic
1031488169 7:122354863-122354885 TTGGCTAGACAACCCTATCTTGG - Intronic
1033109127 7:138559340-138559362 GTTGCTACTCATCCCCATCATGG - Intronic
1034481096 7:151320918-151320940 CTGGGTCCACAGCCCCAACTTGG - Intergenic
1036411629 8:8506877-8506899 CTGGCCACCCAGCCCCAGCTTGG - Intergenic
1036772088 8:11586232-11586254 GTAACTAGACAGTCCCATCTGGG - Intergenic
1037514493 8:19617058-19617080 GTAACTAGACAGTCCCATCTGGG + Intronic
1038745870 8:30254235-30254257 GTAACTAGACAGTCCCATCTGGG + Intergenic
1041095163 8:54342573-54342595 CTGGCTACACAGCCCCTTCTTGG + Intergenic
1043538826 8:81236194-81236216 GTGGCTGCACAGACCCTACTCGG - Intergenic
1046728968 8:117704880-117704902 GTGGGTACACACCCCCATAGTGG - Intergenic
1051153466 9:14112962-14112984 GTGGCTACACCGTCACACCTGGG + Intronic
1053734749 9:41093180-41093202 GTGGCTACACTCGCCCACCTGGG - Intergenic
1058615112 9:106818033-106818055 GCAGCTAGACAGTCCCATCTGGG + Intergenic
1059605952 9:115836038-115836060 GTGGTTACATAGGACCATCTGGG + Intergenic
1061770850 9:132920148-132920170 GAGGTTTCACAGCCCCTTCTGGG - Intronic
1062145687 9:134988477-134988499 GCGGCTACTGAGCCCCAGCTCGG - Intergenic
1185619277 X:1443518-1443540 GTGGACACACACCGCCATCTTGG + Intronic
1185619308 X:1443717-1443739 GTGGACACACACCCCCATCGTGG + Intronic
1185619318 X:1443780-1443802 GTGGACACACACCCCCATCGTGG + Intronic
1185619966 X:1447931-1447953 TTGGATACACAACACCATCTTGG + Intronic
1185620038 X:1448422-1448444 TTGGATACACACCACCATCTTGG + Intronic
1185708751 X:2285280-2285302 GTGACTAGACAGTCCCATCTGGG + Intronic
1185836937 X:3353399-3353421 GCAGCTAGACAGTCCCATCTGGG + Intergenic
1195940334 X:110162410-110162432 GTGGCCAGTCAGCCCCAACTAGG + Intronic
1198824501 X:140685162-140685184 GTGGCCACACAGGTCCCTCTTGG + Intergenic
1199200029 X:145076322-145076344 GCGACTAGACAGTCCCATCTGGG + Intergenic
1200006637 X:153089555-153089577 TTGGCTCTACAGCCCCAGCTCGG - Intergenic
1201239634 Y:11946337-11946359 GAAGCTAGACAGTCCCATCTGGG - Intergenic