ID: 1168971228

View in Genome Browser
Species Human (GRCh38)
Location 20:1932288-1932310
Sequence CAGATCAAGGAGGTGGGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 0, 2: 5, 3: 27, 4: 336}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168971222_1168971228 -6 Left 1168971222 20:1932271-1932293 CCAGGTATGGGATAGAGCAGATC 0: 1
1: 0
2: 0
3: 6
4: 87
Right 1168971228 20:1932288-1932310 CAGATCAAGGAGGTGGGGTCTGG 0: 1
1: 0
2: 5
3: 27
4: 336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168971228 Original CRISPR CAGATCAAGGAGGTGGGGTC TGG Intronic
900321793 1:2088178-2088200 CAGATGAGGGAGGCGGAGTCTGG - Intronic
900961891 1:5927768-5927790 CAGGTGAAGCAGGTGGAGTCGGG - Exonic
902437403 1:16407383-16407405 CTGCTCAAGGAGGTGGGGCAGGG + Intronic
903012980 1:20343706-20343728 CTGACCATGGAGGTGGGGACGGG - Intronic
903231818 1:21926973-21926995 CAGGACCAGGAGGTGGGGGCCGG + Intronic
903669836 1:25028833-25028855 CAGAGGACGGAGGTGGGGTGCGG - Intergenic
903790105 1:25886971-25886993 CAGAACAGGGTGGTGGGGACCGG - Intronic
903926812 1:26836263-26836285 GAGACAAAGGAGATGGGGTCTGG - Intronic
904362990 1:29990568-29990590 CAGATTAAGGAGGTGGAGACAGG - Intergenic
906730352 1:48075603-48075625 AAGATCAAGGAGCTGGCATCTGG + Intergenic
907440425 1:54475081-54475103 CAGAGCAAAGGGGTGGGGCCAGG + Intergenic
907547670 1:55276296-55276318 CTGATCCTGGAGGTGGAGTCAGG - Intergenic
908464259 1:64376093-64376115 AACATCAAGGATGTGGGGGCAGG + Intergenic
910123385 1:83814702-83814724 CAGATTATAGAGGTGGGATCTGG + Intergenic
911836643 1:102627687-102627709 CTGATCAAGGATGTGAGGGCAGG - Intergenic
912523305 1:110262474-110262496 CAGATCAAAGAGGTAGGCACTGG - Intronic
912551755 1:110489560-110489582 CAGTACAATGAGGTGAGGTCAGG + Intergenic
912560951 1:110551161-110551183 CACATCAAGCAGGTGGGGCCAGG - Intergenic
913152677 1:116060886-116060908 CAGCTCCAGAAGGTGGAGTCTGG + Intronic
914878650 1:151530735-151530757 CTGAACAAGGAGGTGGGGCATGG + Exonic
915524235 1:156466442-156466464 AAGAGCAAGGAGGTGGGGTCAGG + Exonic
916590035 1:166181347-166181369 AATATCAAGGAGGTGCAGTCAGG + Intergenic
916860026 1:168793625-168793647 CTCATGGAGGAGGTGGGGTCTGG + Intergenic
917160543 1:172052256-172052278 CTGATCAAGGGGGTGGGGGGTGG + Intronic
918643349 1:186871649-186871671 TAGATAACGGAGGTGGGGGCTGG + Intronic
920302502 1:204997484-204997506 CCCAGCGAGGAGGTGGGGTCTGG + Intronic
922209753 1:223478390-223478412 CAGGTCAATGAGGTGGGGGATGG - Intergenic
923031923 1:230255965-230255987 AAGATCAAGGTGCTGGTGTCTGG + Intronic
923084816 1:230695212-230695234 CAGCTGCAGGAGGTGGGGTGGGG - Intergenic
923147814 1:231210142-231210164 CATAGCAAGGAGGTGGCTTCAGG - Intronic
924498806 1:244616503-244616525 AAGATCAAGGAGCTGGCATCTGG + Intronic
1063354474 10:5385285-5385307 AAGATAAAGGAAGTGGGGTGGGG - Intergenic
1063514470 10:6681407-6681429 TAGATCTAGGAGGTGGGGTCGGG - Intergenic
1063623830 10:7671308-7671330 CAGATGGAGAAAGTGGGGTCAGG - Intergenic
1063687399 10:8250355-8250377 CAAATCAACAAGGTGTGGTCTGG + Intergenic
1063928132 10:11000821-11000843 CAGAGCATGGAACTGGGGTCTGG + Intergenic
1065022417 10:21510819-21510841 CAGATCTAGGAGGTGGGGGAGGG - Intergenic
1065188957 10:23193333-23193355 CAGCTCAGGGAGAAGGGGTCGGG + Intronic
1065916906 10:30360334-30360356 CAGAGGAAGGAGGTGGGGATGGG - Intronic
1065976715 10:30848126-30848148 CAAATGAAGAGGGTGGGGTCTGG + Intronic
1067278339 10:44853450-44853472 CAGAGCCAGGGGGTGGGGTTAGG + Intergenic
1068606114 10:59006870-59006892 AAGGTCAAGGAATTGGGGTCAGG - Intergenic
1070600907 10:77865682-77865704 CAGATCCACCAGGTAGGGTCGGG + Intronic
1070796743 10:79221375-79221397 CAGAACAAAGAGCTGGGGGCTGG - Intronic
1071473441 10:86004179-86004201 AAGATCACAGATGTGGGGTCAGG - Intronic
1071681562 10:87711146-87711168 CAGCTCATGGAGGTGGAGTTGGG - Intronic
1072190738 10:93074521-93074543 CAGCGCAAGAAGGTGGGGGCAGG + Exonic
1072450484 10:95535750-95535772 CAGCTAATGGAGGTGGGGTGAGG + Intronic
1073058207 10:100715453-100715475 GAGACCAACGAAGTGGGGTCGGG + Intergenic
1073443653 10:103568166-103568188 CAGACAAAGGAGGTGGGGCCAGG - Intronic
1073474742 10:103745599-103745621 CAGGTCAAGGAGGTGGGATGGGG + Intronic
1073576392 10:104629613-104629635 GAGATTAAGGAGATGGGGACAGG + Intergenic
1074545420 10:114398724-114398746 GAGATCAAGGAGCTGGGCACCGG - Intronic
1075080474 10:119380281-119380303 CACATCAAGGAGGTGAGAGCTGG - Intronic
1075226815 10:120637045-120637067 CAAATCAAGGAAGAGGGGTCTGG + Intergenic
1075396315 10:122130294-122130316 CAGATGAAGAAGGGGGAGTCTGG - Intronic
1075867960 10:125743784-125743806 CAGACCAAGGAGGCGGTGTGAGG + Intronic
1077066975 11:645675-645697 CAGAGAAAGGAGGTGGGGGATGG + Intronic
1077241439 11:1512731-1512753 CAGCGCTAGGAGGTGGGGCCTGG + Intergenic
1077576308 11:3386713-3386735 AAGATCAAGGTGCTGGTGTCTGG + Intergenic
1079094008 11:17499608-17499630 CAGAAGAAGAAGGTGGGGCCTGG + Intronic
1079726612 11:23887362-23887384 CAGATAAGGGAGATGGGGTTGGG + Intergenic
1081592879 11:44437233-44437255 CACACAGAGGAGGTGGGGTCAGG - Intergenic
1082082009 11:48019372-48019394 CAGAGAAAGGAGGTGGGGTTCGG - Intronic
1084387410 11:68852768-68852790 CAGAGGCAGGAGGTGGGGTGAGG - Intergenic
1084421196 11:69061529-69061551 CAGAGAGAGGAGGTGGGGGCAGG + Intronic
1084563935 11:69919130-69919152 AAGAACAAGGAAGTGGGGCCTGG - Intergenic
1084890439 11:72234162-72234184 CAGAGCAAGGAGGCAGGGCCAGG - Intronic
1084961146 11:72717334-72717356 CAGTCCAGGGAGGTGGGGACAGG + Intronic
1085772850 11:79340304-79340326 CAGCCCAGGGAGGTGGGGTCAGG + Intronic
1085939769 11:81195236-81195258 TAGATCATGGAGGTGGGGTCTGG + Intergenic
1085939778 11:81195270-81195292 TAGATCATGGAGGTGGGGTCTGG + Intergenic
1085939786 11:81195304-81195326 TAGATCATGGAGGTGGGGTCTGG + Intergenic
1087443928 11:98222005-98222027 AAGAACAAGGAGGTGGGGTGCGG - Intergenic
1088013798 11:105035470-105035492 AAGAGCTATGAGGTGGGGTCAGG - Intergenic
1088981931 11:114871795-114871817 CAGAACAATGAGCTGGGGCCGGG + Intergenic
1089148937 11:116349934-116349956 CAGCTCATGGGGCTGGGGTCTGG + Intergenic
1089843148 11:121436288-121436310 CAGATCACTGAGCTGGGGTGTGG - Intergenic
1090412972 11:126521481-126521503 CAGGTCAGGGAGCTGGGGTGGGG + Intronic
1091361392 11:134981084-134981106 CAGGACAAGGAAGTGAGGTCAGG - Intergenic
1091391518 12:129039-129061 CAGATGCAGCAGATGGGGTCGGG - Intronic
1091918947 12:4289202-4289224 CAGATGAAGGGGGTGGGGGTGGG + Intronic
1092170928 12:6373776-6373798 CAGAACAAGGAGAATGGGTCAGG - Intronic
1092290838 12:7158673-7158695 CAGGTCACGGAGGAGGGGCCGGG - Exonic
1094255990 12:28427211-28427233 CACATAAAGGAGGTGGGGGTTGG - Intronic
1095085751 12:38056151-38056173 CAGGTCGAGGAGGTGGTGTTTGG + Intergenic
1096388176 12:51209011-51209033 AAGATCAAGGTGGTGTTGTCTGG - Intronic
1096517242 12:52163798-52163820 CAGATCTAGGGGTTGGGGTGAGG + Intergenic
1096617886 12:52844545-52844567 CAGACCAAGGTGGTGGGACCTGG - Exonic
1096717636 12:53500773-53500795 TTCATCAAGGAGGCGGGGTCGGG + Intergenic
1097246189 12:57609087-57609109 CGGGTCAGGTAGGTGGGGTCTGG - Exonic
1098977045 12:76913526-76913548 CAAATCAAGGTGCTGGGATCCGG + Intergenic
1100145518 12:91672858-91672880 CAGGTCAAGGAGTTGGGGTGGGG - Intergenic
1100687910 12:97006805-97006827 CTGATTACGGAGGTGGGGTTTGG + Intergenic
1102816676 12:115871512-115871534 CAGATCAAGTTGCTGGTGTCCGG - Intergenic
1102867696 12:116387065-116387087 CAGATTAAGGTGCTGGGTTCAGG - Intergenic
1103297713 12:119902637-119902659 CAAATAAAGGGGGTGGGGTGGGG - Intergenic
1103954614 12:124569109-124569131 CAAAACAAGGAGGTGGGGGGGGG - Intergenic
1104162294 12:126191940-126191962 AAGATCCAGGAAGTGGGGCCCGG + Intergenic
1104759151 12:131286853-131286875 CACACCCAGGAGGTGGGTTCTGG + Intergenic
1105647509 13:22337523-22337545 CAGATTTTGGAGGTGGGGCCTGG + Intergenic
1106354010 13:28962312-28962334 AATATCAAGGAGTTGGGGCCAGG - Intronic
1107137952 13:36964957-36964979 CATATGAAGAAGGTGGGGTGAGG + Intronic
1112177582 13:97042236-97042258 CAGTTTGAGGAGGTGGTGTCTGG + Intergenic
1112184440 13:97114510-97114532 CAGATCTAGGGGCTGGGGTGGGG - Intergenic
1112467764 13:99658630-99658652 AGGAACAAGGAGGTGGGGTGGGG + Intronic
1112749394 13:102566596-102566618 CAGATAAAGCAGGTGGGGAGGGG + Intergenic
1113745753 13:112743131-112743153 CAGATCAAGGATGAGGGCACTGG - Intronic
1113868262 13:113543168-113543190 CAGGGGGAGGAGGTGGGGTCCGG - Intronic
1114238877 14:20847635-20847657 CAGATCACGGAGCTGGGGCCAGG - Intergenic
1114246460 14:20919260-20919282 CAGAGCCAGGAGGGAGGGTCTGG - Intergenic
1115307228 14:31945328-31945350 CTGACCAGGGAGGTGGTGTCAGG - Intronic
1115664878 14:35534970-35534992 AAGATCAAGGAGGAGGAGCCCGG + Exonic
1115715122 14:36094965-36094987 CACATCAGGGAGGTTGTGTCTGG - Intergenic
1115929483 14:38475100-38475122 AAGATCATGGAGGTGGGCACTGG - Intergenic
1116859164 14:49979817-49979839 CAGTTCAAGGAGACAGGGTCTGG - Intergenic
1117105175 14:52390925-52390947 CAGGTCAAGGAGATGGTGTTTGG + Intergenic
1118835123 14:69472437-69472459 CAGAACATGGGGGTGGGGACAGG - Intergenic
1121156623 14:91691162-91691184 GAGAGTAAGGTGGTGGGGTCTGG - Intronic
1122051696 14:99065353-99065375 CAGAACAACCAGGTGGGGGCGGG - Intergenic
1122207718 14:100156537-100156559 CAGATGAAGGAGTTGGGGCCTGG - Intronic
1122371720 14:101232846-101232868 CAGGCCCAGGAGCTGGGGTCTGG + Intergenic
1122532073 14:102435204-102435226 CAGATCAGGTATGTGGGTTCGGG + Exonic
1122663876 14:103315830-103315852 CAGATGAAGGAGAGGGGGCCCGG - Intergenic
1122663890 14:103315892-103315914 CAGATGAAGGAGAGGGGGCCGGG - Intergenic
1122766953 14:104079202-104079224 AAGATCAAGGAGCTGGCATCTGG + Intergenic
1122885480 14:104708576-104708598 GAGCCCAAGGAGGTGGGGACGGG + Exonic
1124097813 15:26665599-26665621 CAGAAAAAGGAGCTGGTGTCAGG + Intronic
1124538593 15:30566572-30566594 CAGAGGAAGGAGGTGGGGATGGG + Intergenic
1125458461 15:39885409-39885431 TAGAGCAAGGAGGTGGGGGATGG - Intronic
1126694032 15:51310862-51310884 CACATCTTGGAGGTGAGGTCAGG - Intronic
1127191856 15:56539638-56539660 CAGATCAGAGAAGTGGAGTCTGG - Intergenic
1127318393 15:57818522-57818544 CAGATAAAAGAGGTTGGGCCAGG - Intergenic
1127705920 15:61547083-61547105 TAGAGCAAAGAGGTGGGCTCAGG - Intergenic
1128509853 15:68306719-68306741 GAGAGCAAAGAGGCGGGGTCAGG - Intronic
1130042977 15:80420092-80420114 CAGATCCAGAATGTGGGTTCTGG - Intronic
1130737778 15:86568696-86568718 CAGATTCAGTAGGTGGGGCCTGG - Intronic
1130854148 15:87826184-87826206 CACATCACAGAGGTGGGCTCCGG - Intergenic
1130881857 15:88062188-88062210 CAGAACGGGGAGGTGGGTTCTGG + Intronic
1130987073 15:88851674-88851696 CTGAACTAGGAGGTGGGGCCTGG + Intronic
1131676638 15:94676782-94676804 CAGGAGAAGGAGGTGGGGTCAGG - Intergenic
1132222518 15:100115557-100115579 CAGCTCAAAGAGGATGGGTCAGG + Intronic
1132990155 16:2788126-2788148 CAGAGCAAGATGCTGGGGTCAGG + Intergenic
1134356552 16:13487588-13487610 CAAATGTTGGAGGTGGGGTCTGG - Intergenic
1134640780 16:15827755-15827777 CAGGTCACGGAGGTGAAGTCAGG - Intronic
1134756667 16:16673316-16673338 CACATCAAGGAGCTGGAGTGAGG - Intergenic
1134989401 16:18685847-18685869 CACATCAAGGAGCTGGAGTGAGG + Intergenic
1135631607 16:24039855-24039877 AAGACCAAGGAGGAGGGGGCTGG - Intronic
1136452174 16:30359615-30359637 AAGAACAAGGAGGAGGGGTGGGG + Intronic
1138183664 16:54960480-54960502 CACATGAAGGAGGTGCTGTCTGG - Intergenic
1138723080 16:59104796-59104818 CTGATGTTGGAGGTGGGGTCTGG + Intergenic
1139470378 16:67175006-67175028 GTGGTCAAAGAGGTGGGGTCCGG - Intronic
1139652469 16:68369395-68369417 CAGAGGAGGGAGGTGGGGACAGG + Intronic
1140564220 16:76022303-76022325 CAGATCAAGTTGGATGGGTCAGG + Intergenic
1140899189 16:79352386-79352408 CATAGCACTGAGGTGGGGTCAGG + Intergenic
1142018232 16:87763796-87763818 GAGAGCAAGGTGGTAGGGTCTGG + Intronic
1142377028 16:89711676-89711698 CAGAGCGAGGAGGCGAGGTCAGG - Intronic
1142570139 17:868307-868329 CTCATCAAGGAGCTGGAGTCAGG - Intronic
1142812048 17:2399974-2399996 CAGCTCTGGGAGGCGGGGTCAGG + Intronic
1142886588 17:2916495-2916517 CAGAGCCAGGATGTGGGCTCAGG + Intronic
1143249992 17:5516169-5516191 CAGTTCAGGGAGGTGGGCACAGG + Intronic
1144186083 17:12796556-12796578 AAAATAAAAGAGGTGGGGTCAGG - Intronic
1144329354 17:14210367-14210389 CACAGCAAGGAGGTGGGGACAGG - Intergenic
1144649751 17:16999955-16999977 GAGATCAAGGAGGCGGGGGTGGG - Intergenic
1144995973 17:19268977-19268999 GAGGTCAAGGAGGTGGGGAGAGG + Intronic
1145819155 17:27818034-27818056 CAGAGCAAGGTGGGGGGGTCAGG - Intronic
1146062747 17:29615636-29615658 CAGCCCAAGAAGGCGGGGTCCGG + Exonic
1146285650 17:31572633-31572655 AAAATCAAGGAGGCAGGGTCAGG - Intronic
1146482238 17:33214026-33214048 CAGAACAACCAGGTGGGCTCAGG - Intronic
1147581948 17:41631984-41632006 CCGAGCAAGGAGATGGGGGCTGG - Intergenic
1147875364 17:43617072-43617094 CAGATCCTGGAAGTGGGTTCAGG - Intergenic
1148090203 17:45018866-45018888 CAAAGCAAGGACTTGGGGTCAGG - Intergenic
1150132002 17:62674441-62674463 GAGAACAGGGAGGTGGGGGCTGG + Intronic
1151155068 17:72118314-72118336 CAGGTCAGGGAGGAGGGGTCGGG + Intergenic
1151668496 17:75558837-75558859 CGGATGGAGGAGGTGGGGTGCGG - Intronic
1151668522 17:75558917-75558939 CGGATGGAGGAGGTGGGGTGCGG - Intronic
1151668543 17:75558977-75558999 CAGATGGAGGAGGCGGGGTGCGG - Intronic
1153437206 18:5080088-5080110 CAGATCAAGGAAGGGAGATCTGG + Intergenic
1154492428 18:14932192-14932214 CAGACCTGGGAGGTGGGGTGGGG + Intergenic
1154493911 18:14941840-14941862 CAGTACAAGGAAGTGAGGTCAGG + Intergenic
1155654393 18:28177281-28177303 GAGATCAAGGAGCTGGGGAGGGG + Exonic
1156465549 18:37346175-37346197 CAGTTGGAGGAGGTGGGGGCAGG - Intronic
1157619238 18:49006538-49006560 CAGATAAAGGAGCTGGTGTTTGG + Intergenic
1159384118 18:67700459-67700481 CTAATGATGGAGGTGGGGTCTGG + Intergenic
1159496813 18:69217720-69217742 CTGAGCAAGGAGTTGGGGTAGGG + Intergenic
1161143885 19:2665407-2665429 CAGTTCCAAGAGGTGGGGTGTGG - Intronic
1161301369 19:3544561-3544583 CAGCTCCCGGGGGTGGGGTCGGG - Exonic
1163548487 19:17952516-17952538 CAGGGCATGGGGGTGGGGTCAGG - Intronic
1164220287 19:23187241-23187263 CAGCTGAAGGAGCTGGGGTAGGG - Intergenic
1164931721 19:32180810-32180832 CAGGCCATGCAGGTGGGGTCTGG - Intergenic
1165731630 19:38149594-38149616 TACATCAAGGAGGGGGGGCCTGG - Intronic
1167595885 19:50427931-50427953 CAGATCCAGGAGATGGAGGCCGG + Intronic
1168093406 19:54100551-54100573 AAGAGGAAGGAGGTGGGGACAGG - Intronic
925725451 2:6866261-6866283 CAGAGCTAGGAGTTGAGGTCGGG - Intronic
925777205 2:7347213-7347235 CAGATGTAGGAGGTGAGCTCAGG + Intergenic
926299258 2:11590403-11590425 CAGAGCAAGCAGGTGGGACCAGG - Intronic
927148488 2:20182085-20182107 CCGAGGAAGGAGGTGGGGACAGG + Intergenic
928324650 2:30309870-30309892 AAGATTGTGGAGGTGGGGTCTGG - Intronic
929695135 2:44108026-44108048 CAGTTAAAGGAAGTGGGGTGGGG + Intergenic
929915905 2:46135355-46135377 CAGAGCATGGAAGTGGGGTCAGG + Intronic
930381874 2:50640154-50640176 GAGAACATTGAGGTGGGGTCTGG - Intronic
932317148 2:70792382-70792404 CTGGTCAAGGTGGTGGTGTCAGG + Intergenic
932345184 2:70990785-70990807 CAGATCAAGGGAGTGAAGTCAGG + Intronic
934779500 2:96960686-96960708 CAGATCCAGTGGGTGGGGTTGGG - Intronic
935812716 2:106815695-106815717 CAGATGAAGGAACTGGGGTTTGG + Intronic
937246551 2:120497592-120497614 CAGCTCAGGGAGGTGGTGTCAGG + Intergenic
938241077 2:129742638-129742660 CAGGTGAAGCAGGTGAGGTCTGG + Intergenic
938314191 2:130315049-130315071 CAGAACCTGGGGGTGGGGTCAGG + Intergenic
938673890 2:133611271-133611293 CAGATGGAGGAGGTGGTGGCGGG - Intergenic
939014606 2:136887427-136887449 CCAATGATGGAGGTGGGGTCAGG + Intronic
939739492 2:145887826-145887848 CAGAACAAGGTGGTGGGGGTTGG - Intergenic
940189867 2:151029221-151029243 CAGGACAAGGAAGTGTGGTCTGG + Intronic
941922910 2:170869976-170869998 CCAATGATGGAGGTGGGGTCTGG + Intergenic
944273823 2:197812969-197812991 CAGATCTGGGAGGTGGGGTGTGG - Intronic
945216948 2:207444046-207444068 CAGATCCACAAGGAGGGGTCAGG + Intergenic
946059864 2:216932765-216932787 CACAGCTAGGAGGAGGGGTCAGG - Intergenic
946656823 2:221957644-221957666 CAAAACAAGGAGGATGGGTCAGG + Intergenic
947551727 2:231051310-231051332 CAGAGCAAGGGGCTGGGGGCGGG - Intergenic
947965581 2:234278677-234278699 CTCATGATGGAGGTGGGGTCTGG - Intergenic
948029046 2:234801351-234801373 CAGAGCAGGGAGGATGGGTCTGG + Intergenic
948656138 2:239477701-239477723 AAGATCACGGAGGTGCGGTAGGG - Intergenic
1168768982 20:402151-402173 CAGATCATGGGGGTGGGGGTGGG + Intergenic
1168971228 20:1932288-1932310 CAGATCAAGGAGGTGGGGTCTGG + Intronic
1169216387 20:3796816-3796838 CGAATCCAGGAGGTGGAGTCCGG + Intronic
1171994261 20:31720122-31720144 CAGATAACTGGGGTGGGGTCAGG - Intronic
1172291690 20:33781429-33781451 AAGGGCAAGGAGGTGGGGTGGGG + Intronic
1173527434 20:43743949-43743971 CAGATGGAGGAGGTGTGGTTAGG + Intergenic
1174001489 20:47378228-47378250 AAGATCAAGGAGGAGGCGTGGGG + Intergenic
1174657234 20:52181751-52181773 CAGATTCAGGAGGTGGAGCCCGG + Intronic
1175500389 20:59445962-59445984 CCAATCAAAGAGGTGGGTTCAGG + Intergenic
1175948112 20:62568094-62568116 AGGGTCAAGGAAGTGGGGTCAGG + Intronic
1176552309 21:8231493-8231515 CAGGTCAAGGAGGTGGTGGTTGG - Intergenic
1176571214 21:8414085-8414107 CAGGTCAAGGAGGTGGTGGTTGG - Intergenic
1176579128 21:8458647-8458669 CAGGTCAAGGAGGTGGTGGTTGG - Intergenic
1178234247 21:30823091-30823113 CAGATATTGGAGGTGGGGCCTGG + Intergenic
1178635076 21:34295261-34295283 CAGATCATGGAGGTGGGCTGTGG + Intergenic
1178953850 21:37006474-37006496 AAGCTCAAGGAGGTGGCGCCGGG - Intronic
1179178449 21:39025636-39025658 CAGATGTTGGAGGTGGGGCCTGG - Intergenic
1181316291 22:21972865-21972887 CAGAGCCAGGATGTGGGTTCAGG + Intronic
1181805532 22:25372469-25372491 AAGTTCTAGCAGGTGGGGTCTGG - Intronic
1182289734 22:29268205-29268227 CAGGCCACGGGGGTGGGGTCAGG - Intronic
1182635513 22:31723548-31723570 CAGATCTTGGGGGTGGGGTTAGG + Intronic
1183022203 22:35036410-35036432 AAGATCAAGGTGCTGGTGTCTGG - Intergenic
1184579818 22:45408418-45408440 AAGATGAAGGAGGGAGGGTCGGG - Intronic
1184588022 22:45460809-45460831 GTGCTCAAGGAGGTGGGGCCAGG - Intergenic
1184607884 22:45584749-45584771 CAGATCAAGGATGATGGGACAGG + Intronic
1185028942 22:48431704-48431726 CAGATGACGGTGGTGGGGTGGGG - Intergenic
1185250306 22:49798278-49798300 TAGCTGAAGGAGCTGGGGTCGGG - Intronic
1185309569 22:50146461-50146483 CAGTGCAGGGGGGTGGGGTCGGG + Intronic
1203257310 22_KI270733v1_random:148277-148299 CAGGTCAAGGAGGTGGTGTTTGG - Intergenic
950459229 3:13111382-13111404 CCCATCAGGAAGGTGGGGTCAGG - Intergenic
953998317 3:47537104-47537126 CAGATGACTGAGGTGGGGTTGGG + Intergenic
954217545 3:49132912-49132934 CAAAGCAAGGAGGAGGGCTCGGG - Intronic
954224106 3:49171761-49171783 CAGCTCAAGGATGTGGGGGGCGG - Intronic
954440297 3:50518100-50518122 CAGAATGAGGAGGTGGGGTGTGG + Intergenic
954805996 3:53221027-53221049 CAGATCAAGGAGGGGGATTGGGG + Intergenic
955519428 3:59760769-59760791 CAGATCCAGGAGGCAGTGTCTGG - Intronic
958636858 3:96755850-96755872 TAGAACAAGGAGTTGGGGTAGGG + Intergenic
960360134 3:116700720-116700742 CAGATCAAGAATATAGGGTCTGG + Intronic
961078361 3:124002989-124003011 CTGCTGAAGGAGGTGGGGGCGGG - Intergenic
961216822 3:125166138-125166160 CAGATCTCGGAGGTGTGGTCAGG - Intronic
961603853 3:128079223-128079245 CAGGTGAAGGAAGCGGGGTCCGG - Intronic
963711633 3:148754142-148754164 CAGATCATGGTGCTGGGTTCAGG - Intergenic
964753094 3:160070127-160070149 CAGATCAAGGAGGTACATTCAGG - Intergenic
966314036 3:178625285-178625307 CAGGACAAGGGGGTGGGGGCGGG + Intronic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
966875640 3:184320239-184320261 CAGATCCAGTAGGTGGAGCCAGG - Intronic
967821635 3:193844172-193844194 GTGATAAAGGAGGTGGGGTCAGG + Intergenic
968192251 3:196677180-196677202 CAGATAAAGGTTGTGGGGACAGG - Intronic
968432653 4:567818-567840 CAGACCCAGGAGGAGGAGTCAGG + Intergenic
968540136 4:1164106-1164128 TGGAGCAAGGAGGTGGTGTCAGG - Intergenic
968551368 4:1225404-1225426 CAGATCCGCGAGGTGGCGTCCGG - Exonic
970793577 4:19888333-19888355 CAGATAGAAGAGGTAGGGTCGGG - Intergenic
970952030 4:21767420-21767442 GAAATCAAGGAGATGGGGTTAGG + Intronic
971403547 4:26299112-26299134 AAAATAAAGGAGTTGGGGTCAGG + Intronic
971672692 4:29583429-29583451 CTGATTTTGGAGGTGGGGTCTGG - Intergenic
973628061 4:52792382-52792404 AAGATCAAGGTGCTGGGATCTGG + Intergenic
974156013 4:58073775-58073797 CAAATATTGGAGGTGGGGTCTGG + Intergenic
976163125 4:82225054-82225076 CAGATGAAGGAGCAGTGGTCTGG - Intergenic
976555663 4:86448711-86448733 CAGAGCAGGGAGGTGGCTTCAGG + Intronic
985663218 5:1167770-1167792 CAGAAGAAGCAGGTGTGGTCAGG + Intergenic
986538783 5:8821805-8821827 CTAATCATGGAGGTGGGGCCTGG + Intergenic
986817993 5:11433768-11433790 CCAATGCAGGAGGTGGGGTCTGG - Intronic
987041282 5:14065085-14065107 CAAATGAAGGATGTGGTGTCTGG + Intergenic
992185683 5:74242125-74242147 TAGATCATGGTGGTGGGGGCTGG - Intergenic
993746069 5:91598579-91598601 CAGATGAAGGAGTTGGGGAGAGG - Intergenic
995209577 5:109521916-109521938 TAGAGCAAGGGGGTGGGGTAGGG - Intergenic
998883255 5:146666954-146666976 CAGATCTAGGAGGAGAGGTTAGG - Intronic
999364702 5:151014617-151014639 AAGATCAAGGATTTGGGATCAGG - Intergenic
1000396187 5:160777025-160777047 CACATCAGGGAGGCAGGGTCTGG - Intronic
1001476700 5:172055577-172055599 AAGATCAAGCAGGTGGGGGCCGG - Exonic
1002661030 5:180791271-180791293 CAGGTCAGGGAGAAGGGGTCTGG + Exonic
1002776017 6:327903-327925 GAGATCATGGATGTGAGGTCAGG + Intronic
1003408047 6:5839332-5839354 CAGGTGAAGCAGGTGAGGTCAGG + Intergenic
1004012454 6:11702687-11702709 CAGAGAAAGGAGGTGAGGCCAGG + Intergenic
1004323822 6:14655109-14655131 CTGATGTTGGAGGTGGGGTCTGG - Intergenic
1005768216 6:29036240-29036262 CAGGTCACCGAGGTGGGGTGGGG + Intergenic
1006734573 6:36263896-36263918 CAAATCAAGGTGGCGGGCTCTGG - Intronic
1007450478 6:41938024-41938046 CAGCTAAAGGGGGTGGGGTGGGG - Intronic
1009541289 6:64962438-64962460 CAGAACAAGTAGGTGGGGCATGG + Intronic
1013611706 6:111802103-111802125 CAGATGTTGGAGGTGGGGCCTGG + Intronic
1016793916 6:148096951-148096973 CAAATGAAGAAGCTGGGGTCTGG + Intergenic
1019395133 7:813980-814002 CAGACCCAGGCGGTGGGTTCTGG + Intergenic
1019510994 7:1417240-1417262 CTGGTCAAGGACGTCGGGTCTGG - Intergenic
1021571925 7:22074802-22074824 CAGATCCAGGAGGTTTGGTATGG + Intergenic
1021927362 7:25546250-25546272 CAGGGCAAGGAGGAGGGGTTGGG + Intergenic
1022650246 7:32267440-32267462 CAGATGAAGAAAGTGGAGTCAGG + Intronic
1023528922 7:41133573-41133595 CAGAAGAAGGGGGTGGGGGCGGG + Intergenic
1023802638 7:43848214-43848236 CAGATGAAGCAGGGGGGCTCGGG + Intergenic
1024044662 7:45578510-45578532 AAGATCATGGGGGTGGGGTAGGG + Intronic
1024532861 7:50407526-50407548 CAGAGTGAGGAGGTGGGGTTGGG + Intergenic
1026226639 7:68447746-68447768 GAGATTAAGCAGGTGGGGTCTGG + Intergenic
1026459763 7:70603551-70603573 CAAGTCAAGGATGTGGGGGCAGG + Intronic
1028263003 7:88686897-88686919 CAGGTCAAGGTGGTGGTGGCCGG + Intergenic
1028418126 7:90601588-90601610 CTGGACAAAGAGGTGGGGTCTGG - Intronic
1028835841 7:95374088-95374110 CAGATCATGGAGGGGGAGTGGGG - Intronic
1029224456 7:99014777-99014799 AAGATCAAGGATCTGGAGTCTGG + Intergenic
1030106746 7:105993885-105993907 CAGATCAAGGAGATCTGGGCAGG + Intronic
1032389164 7:131544573-131544595 CAGATCAGGGAGGCGTGGGCAGG + Intronic
1033979306 7:147144335-147144357 AAGATAAAGGTGCTGGGGTCAGG - Intronic
1034743678 7:153502530-153502552 CTGATCAGGGTGGTGGGGTGGGG - Intergenic
1035068495 7:156124555-156124577 CAGCACAAGGAGGTGGGGGCGGG - Intergenic
1035131311 7:156656758-156656780 CTGAGCAAAGCGGTGGGGTCAGG - Intronic
1035370729 7:158377277-158377299 CACATCAAGCACGCGGGGTCAGG + Intronic
1035793182 8:2326222-2326244 CAGGGAGAGGAGGTGGGGTCGGG + Intergenic
1035799622 8:2395483-2395505 CAGGGAGAGGAGGTGGGGTCGGG - Intergenic
1036097734 8:5741988-5742010 CAGAACAAGGAGGTGTCGCCTGG - Intergenic
1037590815 8:20310612-20310634 GAGATTAAGGAGGGTGGGTCAGG - Intergenic
1037957683 8:23071590-23071612 CAGAGCCAGGACCTGGGGTCCGG - Intergenic
1037962027 8:23105001-23105023 CAGAGCCAGGACCTGGGGTCAGG - Intronic
1037965315 8:23129505-23129527 CAGAGCGAGGACCTGGGGTCAGG - Intergenic
1037969427 8:23161408-23161430 CAGAGCCAGGACCTGGGGTCAGG + Intronic
1041023079 8:53657777-53657799 CAGAGCAAGGATGGGGGGTGGGG - Intergenic
1041309733 8:56503162-56503184 CAGGGAAAGGAGATGGGGTCTGG + Intergenic
1041359545 8:57037978-57038000 CAGATGAACAATGTGGGGTCAGG - Intergenic
1042877431 8:73452032-73452054 CAGAGCAAGGAGCTGGGTGCAGG + Intronic
1047270384 8:123352158-123352180 CAGAGCAAGGAGGTGAGGGGAGG - Intronic
1049291683 8:141806660-141806682 CAGCTCAAGGAGGTGAGGGAGGG - Intergenic
1050457713 9:5849476-5849498 CATAGCAAGGAGCTGGGGTTGGG - Intergenic
1050958072 9:11689630-11689652 GAGATAAAGAAGGTAGGGTCTGG + Intergenic
1051438487 9:17057424-17057446 CAGATGAGGGAGGTGGGGGTGGG + Intergenic
1054800661 9:69345160-69345182 CAGGTGAAGGAGGCTGGGTCGGG + Intronic
1055855360 9:80679562-80679584 CAGATGAAGAAGCTGAGGTCTGG - Intergenic
1056759100 9:89402515-89402537 CAGATGAAGAATGTGGTGTCGGG + Intronic
1057036600 9:91816221-91816243 TAGAGCATGGAGGTGGGGCCAGG - Intronic
1058129474 9:101233689-101233711 AATATCAAGGAGCTGGGATCTGG - Intronic
1058897268 9:109411251-109411273 CAGATGAAGAAGCTGAGGTCAGG + Intronic
1059439009 9:114292323-114292345 CAGAGCAAGGAGGTGGCTTCTGG - Intronic
1059492757 9:114682617-114682639 GAGGTCAAGGTGGTGGGGTGGGG - Intergenic
1059510263 9:114838893-114838915 AAGATCAAGGAGCTGGCATCTGG + Intergenic
1060036315 9:120259002-120259024 GAGGTCAAAGAGGTGGAGTCAGG - Intergenic
1060172890 9:121476302-121476324 TGGAGCAAGGAGGTGGGGTGGGG - Intergenic
1060281846 9:122220337-122220359 CAGATCCTTGAGGTGGGGTTAGG + Intronic
1061296380 9:129679084-129679106 CCAATCAGGGAGGTGGGGACGGG + Intronic
1061306622 9:129736251-129736273 AAGCTCAAGGTGGAGGGGTCTGG + Intergenic
1061751377 9:132779825-132779847 CAGAGCAAAGAGTTGGGTTCAGG + Intronic
1062094302 9:134695066-134695088 CTGATCCAGGAAGTGGGCTCAGG - Intronic
1062121723 9:134837406-134837428 CAGATTAGGGAGCAGGGGTCTGG - Intronic
1062484872 9:136769759-136769781 GAGAACAAGCAGGTGGGGACTGG - Intergenic
1062504359 9:136865765-136865787 CAGAGGCAGGAGGTGGGGACGGG - Intronic
1062618366 9:137408060-137408082 CACAGCAAGGAGGTTGGGCCAGG - Intronic
1062655775 9:137604218-137604240 CAGGTCAGGGAGGAGGAGTCTGG - Intergenic
1203473489 Un_GL000220v1:130105-130127 CAGGTCAAGGAGGTGGTGGTTGG - Intergenic
1187146978 X:16645938-16645960 CAGATCAAGGTGCTGGCATCTGG - Intronic
1187746626 X:22416186-22416208 CCGATGTTGGAGGTGGGGTCTGG + Intergenic
1190681625 X:52831167-52831189 CAGACCCAGGAGCTGGGGACAGG + Intergenic
1196458898 X:115909678-115909700 CAGATCATGAATGTGGGGTGGGG - Intergenic
1199570550 X:149263100-149263122 CAGATTAAGCAGGTGAAGTCAGG - Intergenic
1201160333 Y:11160411-11160433 CAGGTCCAGGAGGTGGGCACTGG - Intergenic