ID: 1168971642

View in Genome Browser
Species Human (GRCh38)
Location 20:1935311-1935333
Sequence AACCTAGCCCTGCTTATCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 78}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168971642 Original CRISPR AACCTAGCCCTGCTTATCAC CGG Intronic
901184430 1:7363649-7363671 AAAATAGACCTGCTAATCACGGG - Intronic
901275211 1:7985993-7986015 ATCCGAGCCCTGTTTACCACTGG + Intergenic
903001135 1:20266698-20266720 ATCCTGGCCCTGCTGTTCACTGG - Intergenic
903044049 1:20552805-20552827 AAGCTAGCCCTGCCTGGCACTGG + Exonic
903180457 1:21602536-21602558 ATCCTAGCTCTGCCCATCACTGG + Intronic
907428587 1:54397171-54397193 TAGCTAGCCTGGCTTATCACAGG + Intronic
912752819 1:112299544-112299566 AATCTGGCCCTGCTTATAGCAGG + Intergenic
913196897 1:116464562-116464584 ATCCTAGCTCTGCCTCTCACAGG - Intergenic
913331678 1:117672810-117672832 ATCCCAGCCCTGCTTCTCAGAGG - Intergenic
915432805 1:155879589-155879611 AACCTGTCCCTGCATTTCACAGG - Intronic
916207973 1:162333669-162333691 GATCTAGCCCTGCCTCTCACTGG + Intronic
919920524 1:202164194-202164216 AATCCAGCCCTGCTTGGCACTGG + Intergenic
920388069 1:205581871-205581893 ACCCTTGCCCTGCTGCTCACTGG - Intronic
921516379 1:216097760-216097782 ATACTAGCCCTGCATATCATAGG + Intronic
1062961555 10:1576555-1576577 GACCTAGCACTGCTTATCCCTGG - Intronic
1068762165 10:60724265-60724287 AACATAGCCCTGCTGATCTACGG + Intronic
1077761184 11:5100497-5100519 AACCTATCCCTAGGTATCACTGG - Intergenic
1084631221 11:70352471-70352493 AACCTGGCCCTGTTGGTCACTGG + Intronic
1089281207 11:117375861-117375883 AACTGAGCCCTGCCCATCACAGG + Intronic
1089745126 11:120611251-120611273 ATCCTAGCTCTGCTGATTACTGG + Intronic
1091553064 12:1551332-1551354 CACCAAGATCTGCTTATCACAGG - Intronic
1092970864 12:13693533-13693555 AACCCAGGGCTGCTTCTCACAGG + Intronic
1092985388 12:13840180-13840202 CACCCAGCCCTCCATATCACTGG + Intronic
1102149368 12:110678167-110678189 ATCCTAGCCTTGCTTCTCGCTGG - Intronic
1107926846 13:45271295-45271317 AAACTAGCGCTGATTATAACTGG + Intronic
1110947092 13:81435736-81435758 AATCTTCTCCTGCTTATCACAGG + Intergenic
1112370877 13:98792371-98792393 GACCAAGCCTTGCTTATGACAGG - Intergenic
1119086241 14:71741837-71741859 AACCTAACCCAGCTTATCACCGG - Intergenic
1124555819 15:30724907-30724929 AAACTAGCCCTGCCTTTCCCCGG + Intronic
1124675458 15:31680840-31680862 AAACTAGCCCTGCCTTTCCCCGG - Intronic
1130716608 15:86341007-86341029 AGCCTAGCCCTGCTCCCCACTGG - Intronic
1133123426 16:3627162-3627184 CACCCAGCCCTCTTTATCACTGG + Intronic
1138862158 16:60771568-60771590 AACAGAGCCCTGCCTATCTCTGG + Intergenic
1146515399 17:33485334-33485356 ATTCTAGCCCTGATTCTCACTGG - Intronic
1146824829 17:36013248-36013270 AACCTGAACTTGCTTATCACTGG + Exonic
1148667508 17:49385869-49385891 AAGCTGGCCCTGCTCCTCACAGG - Intronic
1150478911 17:65494665-65494687 AACCTGGACCTGCTTGTCCCAGG + Intergenic
1150648088 17:66992410-66992432 AACCTAGCACTGGTTCTCCCAGG + Intronic
1157224377 18:45849322-45849344 AGCCTAGGCCTGCCCATCACAGG + Exonic
1158686315 18:59617793-59617815 ACCTGAGCCATGCTTATCACAGG + Intronic
1163583982 19:18154189-18154211 ACCCTAGCCCTGTCCATCACAGG + Intronic
1166794312 19:45417208-45417230 GTCCTAGCACTGCTTAGCACGGG - Intronic
929013838 2:37474574-37474596 GACCTAGCCCTGCTGCTAACTGG - Intergenic
937097219 2:119243158-119243180 AACATGGCCCTGCCTGTCACAGG - Intronic
937314997 2:120926462-120926484 AACTTAACCCTGCTTCCCACTGG + Intronic
941717633 2:168780337-168780359 AAACTTGCCCTCCTTACCACGGG - Intergenic
941853069 2:170203605-170203627 AATCTAGACCTGAATATCACTGG + Intronic
946608273 2:221430295-221430317 AAGCTAGACCTGAGTATCACTGG + Intronic
948384501 2:237573191-237573213 AACTTACACCTGCTTATCATAGG + Intergenic
1168971642 20:1935311-1935333 AACCTAGCCCTGCTTATCACCGG + Intronic
1169271403 20:4202205-4202227 AGCCAATCCCTCCTTATCACAGG - Intergenic
1176590425 21:8643929-8643951 ATCCTACCCCTTCTTATCAAGGG - Intergenic
949339489 3:3013472-3013494 AACGGAGTCCTGCTTATTACTGG + Intronic
951097628 3:18650299-18650321 AACTGAGCCCAGCTTTTCACTGG + Intergenic
953846348 3:46429935-46429957 AACATAGCTCAGCTTATCAAAGG - Intergenic
956591687 3:70922084-70922106 ATCTTAGCTCTGCTTCTCACTGG - Intergenic
964820388 3:160762462-160762484 AACATAACACTGCTTTTCACAGG - Intronic
967751022 3:193116568-193116590 AACCTAGTCCTCCTTATTATAGG + Intergenic
971967905 4:33585890-33585912 ATCCTATGACTGCTTATCACAGG - Intergenic
975387665 4:73776644-73776666 ATCCCAGTCCTGCTTACCACAGG + Intergenic
981021043 4:140029164-140029186 AACCAAACCCTGCTCAGCACAGG + Intronic
981988798 4:150890618-150890640 AACCTAGACCTTTTTATCACTGG - Intronic
991284383 5:64954901-64954923 AATGTAGCACTGCTTATCATGGG - Intronic
992013218 5:72551371-72551393 ACCCTAGGCCTGCTCATCAGTGG + Intergenic
996089151 5:119333818-119333840 TACCTCTCCCTGCTTAACACTGG - Intronic
997059745 5:130487548-130487570 AGCCTAGTTCTGCTTTTCACTGG - Intergenic
997398178 5:133581242-133581264 AATCTAGCTCTGCTGACCACTGG - Intronic
998853710 5:146375085-146375107 AACCTTGGGCTGGTTATCACTGG + Intergenic
1001559397 5:172659414-172659436 AACCTCAGCCAGCTTATCACTGG + Intronic
1002154970 5:177270313-177270335 AAACTAGTTCTGCTTATAACAGG - Intronic
1008589381 6:52977799-52977821 AACCGAATCCTGCTTCTCACAGG - Intergenic
1011750405 6:90449483-90449505 AACCTAGGCCTCCTTCCCACTGG - Intergenic
1023203656 7:37724964-37724986 AAGCTAGCACGGCTTGTCACTGG - Intronic
1049306632 8:141907469-141907491 CACCGAGCCATGCTCATCACAGG - Intergenic
1051026202 9:12614687-12614709 TACCCAGGGCTGCTTATCACAGG - Intergenic
1051902404 9:22057825-22057847 CACCTTGCCCAGCCTATCACTGG - Intergenic
1052742103 9:32403172-32403194 AACCTAGCTCTGCCTCTTACTGG + Intronic
1056397247 9:86193252-86193274 GAGGTAGCCCTTCTTATCACAGG + Intergenic
1059172348 9:112137673-112137695 AACTTAGCCATGCACATCACTGG + Intronic
1187684589 X:21803728-21803750 ATCCTAGGACTGCTTATCTCTGG - Intergenic
1189122189 X:38406960-38406982 AACCTAGACATGCCTGTCACAGG + Intronic
1190781116 X:53596159-53596181 GACCTAGCCCTTCTTGTCTCTGG - Intronic