ID: 1168973339

View in Genome Browser
Species Human (GRCh38)
Location 20:1945950-1945972
Sequence AAGGGCACTGTGGAGTTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168973339_1168973345 10 Left 1168973339 20:1945950-1945972 CCCATCAACTCCACAGTGCCCTT No data
Right 1168973345 20:1945983-1946005 TTCCTGCCTCCCGATACCCTTGG No data
1168973339_1168973353 27 Left 1168973339 20:1945950-1945972 CCCATCAACTCCACAGTGCCCTT No data
Right 1168973353 20:1946000-1946022 CCTTGGAAGGACCCCTTTAACGG No data
1168973339_1168973354 28 Left 1168973339 20:1945950-1945972 CCCATCAACTCCACAGTGCCCTT No data
Right 1168973354 20:1946001-1946023 CTTGGAAGGACCCCTTTAACGGG No data
1168973339_1168973347 14 Left 1168973339 20:1945950-1945972 CCCATCAACTCCACAGTGCCCTT No data
Right 1168973347 20:1945987-1946009 TGCCTCCCGATACCCTTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168973339 Original CRISPR AAGGGCACTGTGGAGTTGAT GGG (reversed) Intergenic
No off target data available for this crispr