ID: 1168973606

View in Genome Browser
Species Human (GRCh38)
Location 20:1947620-1947642
Sequence GCTGATGGAGGGCCTCGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168973600_1168973606 -4 Left 1168973600 20:1947601-1947623 CCAAACATTCCCATCGTCGGCTG No data
Right 1168973606 20:1947620-1947642 GCTGATGGAGGGCCTCGAGCTGG No data
1168973597_1168973606 19 Left 1168973597 20:1947578-1947600 CCTTGAAGGGCAGACTTACTCCA No data
Right 1168973606 20:1947620-1947642 GCTGATGGAGGGCCTCGAGCTGG No data
1168973598_1168973606 -1 Left 1168973598 20:1947598-1947620 CCACCAAACATTCCCATCGTCGG No data
Right 1168973606 20:1947620-1947642 GCTGATGGAGGGCCTCGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168973606 Original CRISPR GCTGATGGAGGGCCTCGAGC TGG Intergenic
No off target data available for this crispr