ID: 1168978573

View in Genome Browser
Species Human (GRCh38)
Location 20:1986344-1986366
Sequence CTCCAGCTTCTCCCTCCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 497
Summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 458}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168978567_1168978573 1 Left 1168978567 20:1986320-1986342 CCCTTCAGTCCTCTCATCTCCAG 0: 1
1: 0
2: 4
3: 37
4: 367
Right 1168978573 20:1986344-1986366 CTCCAGCTTCTCCCTCCAGGTGG 0: 1
1: 0
2: 3
3: 35
4: 458
1168978565_1168978573 7 Left 1168978565 20:1986314-1986336 CCAGGCCCCTTCAGTCCTCTCAT 0: 1
1: 0
2: 3
3: 29
4: 345
Right 1168978573 20:1986344-1986366 CTCCAGCTTCTCCCTCCAGGTGG 0: 1
1: 0
2: 3
3: 35
4: 458
1168978566_1168978573 2 Left 1168978566 20:1986319-1986341 CCCCTTCAGTCCTCTCATCTCCA 0: 1
1: 0
2: 4
3: 102
4: 1205
Right 1168978573 20:1986344-1986366 CTCCAGCTTCTCCCTCCAGGTGG 0: 1
1: 0
2: 3
3: 35
4: 458
1168978569_1168978573 -8 Left 1168978569 20:1986329-1986351 CCTCTCATCTCCAGCCTCCAGCT 0: 1
1: 0
2: 5
3: 73
4: 719
Right 1168978573 20:1986344-1986366 CTCCAGCTTCTCCCTCCAGGTGG 0: 1
1: 0
2: 3
3: 35
4: 458
1168978568_1168978573 0 Left 1168978568 20:1986321-1986343 CCTTCAGTCCTCTCATCTCCAGC 0: 1
1: 0
2: 4
3: 41
4: 417
Right 1168978573 20:1986344-1986366 CTCCAGCTTCTCCCTCCAGGTGG 0: 1
1: 0
2: 3
3: 35
4: 458
1168978562_1168978573 30 Left 1168978562 20:1986291-1986313 CCTTCGTAACTGCTGTGTACTGC 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1168978573 20:1986344-1986366 CTCCAGCTTCTCCCTCCAGGTGG 0: 1
1: 0
2: 3
3: 35
4: 458
1168978564_1168978573 8 Left 1168978564 20:1986313-1986335 CCCAGGCCCCTTCAGTCCTCTCA 0: 1
1: 0
2: 1
3: 38
4: 443
Right 1168978573 20:1986344-1986366 CTCCAGCTTCTCCCTCCAGGTGG 0: 1
1: 0
2: 3
3: 35
4: 458

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168978573 Original CRISPR CTCCAGCTTCTCCCTCCAGG TGG Intronic
900114511 1:1022758-1022780 GTCCAGCTTCTCCCTAGAAGGGG - Intronic
900402867 1:2479735-2479757 CTCCATCGACTCCATCCAGGAGG + Exonic
900409817 1:2507461-2507483 CTCCAGCTTCTCCCTCCTGTGGG - Intergenic
900880995 1:5381234-5381256 CTTCAGCTCCTGCCTCTAGGTGG - Intergenic
901626829 1:10629512-10629534 CCCCTTCTTCTCCCTCTAGGAGG + Exonic
902383767 1:16065025-16065047 CTCCACCCTCTCTCCCCAGGAGG + Intronic
902780243 1:18700294-18700316 CTGCAGCTGCTCCTTCCTGGAGG - Intronic
903013297 1:20345435-20345457 CCCCAGTTTCTCCCTCCACAGGG + Exonic
903878875 1:26495114-26495136 TTGCAGCCTCTGCCTCCAGGAGG - Intergenic
903977456 1:27160135-27160157 CTACAGCTTCTTCCTCCATAAGG + Intronic
904455536 1:30645831-30645853 CTCTACCTCCTGCCTCCAGGTGG - Intergenic
905263958 1:36738485-36738507 CCCCACCGTCTCCCTCCAGCAGG - Intergenic
905365601 1:37449639-37449661 CTCCACTGTCTCCCTGCAGGAGG - Intergenic
906962109 1:50425150-50425172 CTCCAGCCTCAGCCTCCCGGTGG - Intergenic
908340492 1:63173507-63173529 CTCCAGAATCTCACTCCAGGTGG + Intergenic
909935703 1:81547756-81547778 TCCCAGCTTCTCCCTCCCAGGGG + Intronic
910744837 1:90562154-90562176 CTCCTGCTTCTGCCTCCTAGTGG - Intergenic
912321663 1:108719615-108719637 CTTCAGCTTCTCCCCACAGCTGG - Intronic
913212930 1:116596447-116596469 TTCCAGCTTCTGCCACAAGGTGG - Intronic
914004178 1:143718036-143718058 CTGCAGCTTCGACCTCCCGGGGG + Intergenic
915080040 1:153345776-153345798 CTGCATCTTCTCCCCCCAGCAGG + Intronic
915097239 1:153471712-153471734 CTCCAGCTGGTCCCTCCATTCGG - Intergenic
917633723 1:176915720-176915742 CTCCAGCTTCTTAATGCAGGCGG + Intronic
917988478 1:180347440-180347462 CTGCAGCCTCCCCCTCCCGGGGG + Intronic
918064488 1:181089896-181089918 CTCCACCTCCTCCCCGCAGGGGG - Exonic
918586637 1:186195869-186195891 CTCCACCTTCTCTATGCAGGAGG + Intergenic
918600061 1:186347795-186347817 CTCCAGCTGCTCCCTCCATTCGG - Intronic
918889660 1:190250112-190250134 CTTCTGCTTTTCCCTCTAGGTGG - Intronic
918977768 1:191512793-191512815 CTCCAGCTGGTCCCTCCATTTGG - Intergenic
919737069 1:200959394-200959416 CTCCAGCTTCTGGCTCCATCTGG + Intergenic
919902468 1:202054465-202054487 TTCCAGCCTCCCCCTCAAGGAGG - Intergenic
920499614 1:206477871-206477893 CTCCAGCATCACCCCCCAGCAGG - Intronic
920552951 1:206880163-206880185 CTGCAGCTTCGACCTCCTGGGGG + Intergenic
920567786 1:206989317-206989339 CTCCAGCTTCTTTCTCCATTTGG - Intergenic
920683685 1:208092806-208092828 CACCACCTGCTCCTTCCAGGAGG - Exonic
920791756 1:209099449-209099471 CTCAAGCTTCTCCATTCTGGTGG - Intergenic
920879505 1:209866618-209866640 CTCCAGCTGGTCCCTCCATTCGG - Intergenic
921221917 1:212979548-212979570 ATCCACCTCCTCCCTCCAGCTGG + Intronic
921281499 1:213572202-213572224 CTCCAGCCTTCCCCTCCACGGGG - Intergenic
921926099 1:220711100-220711122 CTCCTGTTTCTTCCTCCAGCTGG - Intergenic
922864941 1:228851988-228852010 CTCCCGCTTTCCCCTCCTGGAGG - Intergenic
922884233 1:229005786-229005808 CTCCAGCTTCTGCCTCCCAATGG - Intergenic
1064070717 10:12226411-12226433 CAGCAGCTGCCCCCTCCAGGAGG - Intronic
1064427893 10:15246019-15246041 CTCAGGCTACTCCCTCCTGGAGG + Intronic
1065874443 10:29984541-29984563 CTCAAGCTTCTGCCTCTGGGTGG - Intergenic
1066642206 10:37565925-37565947 CTTCAGCTGGTCCCTCCATGTGG - Intergenic
1066651606 10:37661324-37661346 CTCCTGCATCTCCCACCATGTGG + Intergenic
1067035388 10:42911754-42911776 CTCCTGCATCTCCCGCCATGTGG + Intergenic
1067144316 10:43682867-43682889 CTCCATCTTCTCTTCCCAGGGGG - Intergenic
1067146440 10:43697475-43697497 TTCCAGTCTCTCCCTCCAGAAGG + Intergenic
1067233613 10:44428318-44428340 CTGCATCTTCACCCTCTAGGAGG + Intergenic
1067827102 10:49584384-49584406 CTTCAGCTCCTCCCACCATGTGG + Intergenic
1069704065 10:70446351-70446373 ATCCAGATTCTGCCTCCTGGAGG - Intronic
1070806775 10:79275370-79275392 GCCCTGTTTCTCCCTCCAGGAGG - Intronic
1073480615 10:103784117-103784139 CTCCTGCATCTCATTCCAGGTGG - Intronic
1074783802 10:116821214-116821236 CTCCAGCTTCTCCTCTGAGGTGG - Intergenic
1075025796 10:118982203-118982225 CTGCAGCTCCCCCGTCCAGGAGG - Intergenic
1075081389 10:119386258-119386280 CTCACGCTTCTCCATCCACGTGG - Intronic
1075719165 10:124574942-124574964 CTCCAGCCTCTGCCTCCTGCCGG + Intronic
1076325424 10:129616857-129616879 CTCCACCTCCTCCCCCGAGGAGG + Intronic
1076878214 10:133227247-133227269 CTCCTGGGCCTCCCTCCAGGCGG - Intergenic
1076909141 10:133378866-133378888 GGCCGGCTTCTCCCTCCATGGGG + Intergenic
1077227695 11:1445561-1445583 CTCCTGGTTCTCCCTACAGCGGG - Exonic
1077278278 11:1728168-1728190 CTCCAGCTCCTTCCTCTAAGAGG - Intergenic
1078000414 11:7490271-7490293 CGCCAGCTTCTCCCTCTTTGAGG - Intronic
1078014939 11:7604884-7604906 GTCCTGTTTCTCCCTCCAGCTGG - Intronic
1078141950 11:8699362-8699384 CTCCAGCTGCTCCCACGCGGTGG - Exonic
1080159879 11:29160853-29160875 CTACTGGTTCTCCCTCCAGGAGG + Intergenic
1080574312 11:33584339-33584361 CTGCAGCTTCTCCATCATGGTGG - Intronic
1080668562 11:34356867-34356889 CACCAGGTTCTCCATGCAGGCGG + Exonic
1081702396 11:45160023-45160045 CTCCAGCCTCTCCCTTCTGCAGG + Intronic
1081907470 11:46678936-46678958 CTCCAACATCTCTCTCCAGGGGG + Exonic
1082063003 11:47876527-47876549 CTCCAGCTGGTCCCTCCATTCGG + Intergenic
1082726321 11:56740957-56740979 TTCCAGCTACTCCCTCAAGAGGG + Intergenic
1083041449 11:59691465-59691487 CTCCAGTTTCTCCCTGGAAGAGG + Intergenic
1083459847 11:62803835-62803857 CTCCATCATCTTCCTCAAGGCGG + Exonic
1083724589 11:64621597-64621619 CTTCAGCTTCTCCCTCTGAGGGG - Intronic
1083729331 11:64644398-64644420 CCCCAACCTCTCCCTCCATGGGG + Intronic
1083863174 11:65436920-65436942 CCCCAGCTTCCACCTCAAGGAGG + Intergenic
1084224210 11:67705311-67705333 CTCCAGCTGGTCCCTCCATTCGG - Intergenic
1085123159 11:73980331-73980353 CTTGGGCTTCTCACTCCAGGTGG + Intronic
1085707346 11:78798651-78798673 CTGCAGCTTCTATCTCCAGCTGG + Intronic
1086157251 11:83681328-83681350 CTCCAGGTCCTAGCTCCAGGCGG - Intronic
1087499714 11:98934193-98934215 CTCCAGCTAAGCCTTCCAGGTGG - Intergenic
1088705043 11:112454398-112454420 CACCCCCATCTCCCTCCAGGTGG - Intergenic
1089284188 11:117395130-117395152 CTGCTGCTTCTCCCTCCGGGCGG - Exonic
1089331451 11:117691784-117691806 CTCTACCTTCTCTCCCCAGGGGG + Intronic
1089978660 11:122754522-122754544 CTCTAGCACCTCCTTCCAGGTGG - Intronic
1090190391 11:124762749-124762771 CTCCGGCCTCTCCCTGCAGCTGG - Intergenic
1090417929 11:126553584-126553606 CCCCAGCTGCTCCCTTGAGGTGG - Intronic
1092074966 12:5665417-5665439 CCCCAGCTTCTGCCTCAGGGAGG + Intronic
1092919956 12:13222370-13222392 CTCCAGCCACACCCTCCCGGGGG - Intergenic
1093735217 12:22613488-22613510 CTCCAGCTGGTCCCTCCATTTGG + Intergenic
1094578207 12:31707831-31707853 CTCCAGCTGGTCCCTCCATTTGG - Intronic
1094870392 12:34596331-34596353 CCCCAGGTTCTCACTCAAGGAGG + Intergenic
1095252862 12:39998986-39999008 CTCCAGCTGGTCCCTCCATTCGG - Intronic
1097840716 12:64318860-64318882 CCCTACCTTCCCCCTCCAGGAGG - Exonic
1099318915 12:81119984-81120006 CTCCAGCTGGTCCCTCCATTTGG + Intronic
1100618080 12:96247211-96247233 CTCCAGCTTCTCCGTCTTGATGG - Exonic
1102234502 12:111285840-111285862 CGCCACCTTCTCCCTCAAGTTGG + Intronic
1102446253 12:113005076-113005098 CTCCTCCTTCTCCCTCCAAAAGG - Exonic
1102469117 12:113149658-113149680 CCCCTCCCTCTCCCTCCAGGCGG + Intergenic
1103187785 12:118975997-118976019 CTCCACCTTCTTCCTGCAGAAGG - Intergenic
1103703522 12:122859797-122859819 CTCCAGCTTCACCCCCGAGCTGG - Exonic
1104331365 12:127849275-127849297 CTCAACCTTCTCCCTCAAGTAGG + Intergenic
1104717917 12:131028854-131028876 CTCCAGCTTGTTATTCCAGGCGG + Intronic
1105216174 13:18287046-18287068 TTCCAGCTTCTGCCACAAGGTGG - Intergenic
1107995739 13:45859044-45859066 CTCCAGAATATCCCTCCAGAGGG + Intergenic
1111452249 13:88434646-88434668 CTCCAGCTGGTCCCTCCACTCGG - Intergenic
1112053677 13:95670558-95670580 CTCCAGCTGGTCCCTCCATTCGG + Intergenic
1112218448 13:97460906-97460928 CTCCAGCTTCACCCTCAACTCGG + Intronic
1112760688 13:102690663-102690685 CTCCACCAACACCCTCCAGGGGG + Intronic
1113513205 13:110872155-110872177 CTCCCGCCTCTCCCTGCGGGGGG + Intergenic
1114209830 14:20605182-20605204 CTGCAGATGCTCCCTCCAGGGGG - Intronic
1114653524 14:24301984-24302006 CTCCAGCTTCTGTCTTCAAGTGG + Exonic
1115133378 14:30080049-30080071 CTGCAGCTTCTCCCGGGAGGCGG - Intronic
1115886755 14:37980773-37980795 CTCCAGCTGCTCCCTCCATTTGG - Intronic
1118216405 14:63812717-63812739 CTCCAGCTGGTCCCTCCATTTGG + Intergenic
1118595063 14:67428842-67428864 CGCCTGCTTCTCTCTCCAGCAGG - Intergenic
1118721977 14:68600768-68600790 CACCAGCTTTTCCCTAAAGGAGG - Intronic
1120792308 14:88596494-88596516 CTCCTGGTTCTCCCTCTATGAGG - Intronic
1121064861 14:90953122-90953144 CTCCAGCTGGTCCCTCCATTCGG - Intronic
1121089283 14:91170114-91170136 CTGCAGCTTCTCCCTGGAGGAGG + Exonic
1123021395 14:105399360-105399382 CTCCAGCTTCTTCCCCCGGGGGG - Exonic
1123098697 14:105779270-105779292 CTCCAGCTGGTCCCTCCATTCGG + Intergenic
1123467884 15:20529654-20529676 CTCCAGGGGCTCCCTGCAGGAGG + Intergenic
1123472386 15:20565029-20565051 CTCCAACCTCCTCCTCCAGGTGG + Intergenic
1123476329 15:20594409-20594431 TTCCAGCATCCTCCTCCAGGAGG - Intergenic
1123641682 15:22405955-22405977 TTCCAGCATCCTCCTCCAGGAGG + Intergenic
1123645617 15:22435324-22435346 CTCCAACCTCCTCCTCCAGGTGG - Intergenic
1123650228 15:22471388-22471410 CTCCAGGGGCTCCCTGCAGGAGG - Intergenic
1123666871 15:22614889-22614911 CTCCAACCTCCTCCTCCAGGAGG - Intergenic
1123728199 15:23124863-23124885 CTCCAGGGGCTCCCTGCAGGAGG + Intergenic
1123732691 15:23160020-23160042 CTCCAACCTCCTCCTCCAGGTGG + Intergenic
1123740634 15:23280230-23280252 CTCCAGGGGCTCCCTTCAGGAGG - Intergenic
1123746364 15:23322328-23322350 CTCCAGGGGCTCCCTTCAGGAGG + Intergenic
1123750824 15:23357400-23357422 CTCCAACCTCCTCCTCCAGGTGG + Intronic
1124278631 15:28345645-28345667 CTCCAGGGGCTCCCTGCAGGAGG + Intergenic
1124283195 15:28381316-28381338 CTCCAACCTCCTCCTCCAGGTGG + Intronic
1124299504 15:28530297-28530319 CTCCAACCTCCTCCTCCAGGTGG - Intronic
1124304069 15:28565963-28565985 CTCCAGGGGCTCCCTGCAGGAGG - Intergenic
1124320711 15:28709462-28709484 CTCCAACCTCCTCCTCCAGGAGG - Intronic
1124481783 15:30085887-30085909 CTCCAACCTCCTCCTCCAGGTGG + Intronic
1124488239 15:30137985-30138007 CTCCAACCTCCTCCTCCAGGTGG + Intronic
1124521808 15:30411314-30411336 CTCCAACCTCCTCCTCCAGGTGG - Intronic
1124532951 15:30522435-30522457 CTCCAGGGGCTCCCTGCAGGAGG - Intergenic
1124536856 15:30554905-30554927 CTCCAACCTCCTCCTCCAGGTGG + Intronic
1124543329 15:30606959-30606981 CTCCAACCTCCTCCTCCAGGTGG + Intronic
1124718097 15:32085676-32085698 ATTCAGTTTCTCCTTCCAGGAGG + Intronic
1124755287 15:32400335-32400357 CTCCAACCTCCTCCTCCAGGTGG - Intronic
1124761796 15:32452686-32452708 CTCCAACCTCCTCCTCCAGGTGG - Intronic
1124765706 15:32485209-32485231 CTCCAGGGGCTCCCTGCAGGAGG + Intergenic
1124776833 15:32596382-32596404 CTCCAACCTCCTCCTCCAGGTGG + Intronic
1125433433 15:39621406-39621428 ATCCAGCTGCTTCCCCCAGGAGG - Intronic
1125753778 15:42048723-42048745 CTTCAGTTTCTCCCTCTATGGGG - Intronic
1129301992 15:74630773-74630795 CTCCCTCTTCTCTCCCCAGGGGG - Exonic
1130408355 15:83623432-83623454 CTCCACATTCTCCCTCCAGCAGG + Intergenic
1131269716 15:90939636-90939658 CTCCAGCTCCTCACTCTGGGAGG - Intronic
1131439034 15:92444746-92444768 CAGCAGCTTCTCCCGCCACGTGG - Exonic
1131958307 15:97761872-97761894 CTCAAGCCTCTTTCTCCAGGAGG - Intergenic
1132032536 15:98450379-98450401 CAACTGCATCTCCCTCCAGGGGG - Intronic
1132071390 15:98779698-98779720 CTCGAGCCTCTCCCTGGAGGAGG + Intronic
1132143792 15:99415035-99415057 TTCCAGCTTCTCCTTCCCTGGGG - Intergenic
1132543512 16:522488-522510 GGCCGGCTTCTTCCTCCAGGGGG + Exonic
1132604330 16:787461-787483 CTCCAGGTTCTGCCACCAGCTGG - Exonic
1132750169 16:1453961-1453983 CTCCAGCTTCTCCTGCCATCTGG - Intronic
1132831882 16:1932460-1932482 TTTCTGCTTCTCCCTGCAGGAGG - Intergenic
1133116856 16:3582390-3582412 CTGGAGCTTCTCCCTGCGGGTGG + Exonic
1133226154 16:4341418-4341440 CTCCGGCCTCAGCCTCCAGGAGG - Exonic
1133723042 16:8512726-8512748 CTCCAGCCTCTCACCCCAGGAGG + Intergenic
1134080569 16:11322349-11322371 CTCCACTGTCTCCCTCCAGGAGG + Intronic
1135093624 16:19543156-19543178 CTCCAGCTGGTCCCTCCATTCGG - Intronic
1135707086 16:24684326-24684348 CTGCAGCGTCTACCTCCTGGGGG - Intergenic
1135887120 16:26320326-26320348 CTCCAGCTTCAGCCTCCCAGTGG - Intergenic
1136030410 16:27498730-27498752 CTCCAACCTCTCTCTCCAGGTGG - Exonic
1136417411 16:30112539-30112561 CTCCAGCTTCTCCTTGTAGAGGG + Exonic
1136500547 16:30667873-30667895 CCCCACCTTCCCCTTCCAGGTGG - Intronic
1136541531 16:30930125-30930147 CTCTAGCTTCTCCCTCTGCGGGG - Exonic
1136933263 16:34437003-34437025 CTCCACCTTCTCCCTCCTCCAGG - Intergenic
1136971309 16:34974811-34974833 CTCCACCTTCTCCCTCCTCCAGG + Intergenic
1137402579 16:48165333-48165355 CACCTGCTTCTCCTTCTAGGGGG - Intergenic
1137564036 16:49522169-49522191 CACCAGTTTGGCCCTCCAGGGGG - Intronic
1138593499 16:58016503-58016525 CTCCATCTGCACTCTCCAGGAGG - Intronic
1139526796 16:67521671-67521693 GTCCAGCCTCGGCCTCCAGGGGG - Intronic
1139546367 16:67651746-67651768 CTCTAGCTGCTCCCTCCAGCTGG - Exonic
1139549983 16:67667667-67667689 CTCCTGCTGCTCCCTACACGGGG - Intronic
1139643435 16:68310358-68310380 CTTCAGGTTCTCCCTCCTCGTGG + Exonic
1140060211 16:71562680-71562702 CTCCAGCTGGTCCCTCCATTTGG + Intronic
1140062419 16:71582264-71582286 CTCCTGCCTCGGCCTCCAGGTGG - Intergenic
1140272980 16:73483047-73483069 CTCCCTCTTCCCCCTCCATGGGG + Intergenic
1140471715 16:75219028-75219050 CTCCTGCTTCTCCCTTGTGGGGG + Exonic
1140816887 16:78629431-78629453 CTCCAGCTTCTGCCTGAAGAAGG - Intronic
1140991518 16:80217312-80217334 ACTCATCTTCTCCCTCCAGGGGG + Intergenic
1141895471 16:86956255-86956277 CTCAGGCTTCTCTCTCCCGGCGG - Intergenic
1142132152 16:88436048-88436070 TCCCAGCTCTTCCCTCCAGGCGG + Exonic
1142247424 16:88976401-88976423 CTCCAGCATCTGCCTCTGGGTGG + Intronic
1142591904 17:1009944-1009966 CAGCAGCTGCTTCCTCCAGGAGG + Intronic
1143033394 17:3980712-3980734 CTTCAGCTGCTCCATCCAGCTGG - Intergenic
1143117064 17:4587117-4587139 CCCCAGCCTCTTCTTCCAGGAGG - Intronic
1143284134 17:5776638-5776660 TTGCAGCTCCTCCCTCCAGGAGG - Intronic
1143372501 17:6449171-6449193 CTCCAGACCCTCACTCCAGGAGG - Intronic
1143394057 17:6577837-6577859 CTCCTGCTCCTCCCACCAGGTGG - Intergenic
1143631137 17:8140943-8140965 CCCCAGCTTCTCCCACCATAGGG - Exonic
1144599824 17:16601636-16601658 CTCCAGCTTCTGCCTCTGGGGGG + Intergenic
1144678943 17:17180106-17180128 CTCAAGCCCCTCCCACCAGGGGG - Intronic
1144710851 17:17400714-17400736 CTCCAGCCTGTCCCACCAGCGGG + Intergenic
1144966041 17:19077882-19077904 CTCCAGGTTCCCACTCCAGCAGG - Intergenic
1144981927 17:19174307-19174329 CTCCAGGTTCCCACTCCAGCAGG + Intergenic
1144986296 17:19203932-19203954 CTCCAGGTTCCCACTCCAGCAGG - Intergenic
1147324963 17:39665710-39665732 CCCCAGCTGCTCCCTGCATGAGG + Exonic
1147405562 17:40209360-40209382 TCCAGGCTTCTCCCTCCAGGTGG + Intergenic
1147962743 17:44177789-44177811 CTCCTGCTGCTCCCTCCATGAGG - Intronic
1148122789 17:45222369-45222391 CGGCAGCTGCCCCCTCCAGGAGG + Intronic
1148327104 17:46789753-46789775 CTCCAGCTTGGACCTCCAGCTGG + Intronic
1148391400 17:47275648-47275670 CTCCCGCCCCTCCCCCCAGGCGG - Intronic
1148455375 17:47808396-47808418 CACCGCCTTCTCCCACCAGGCGG - Exonic
1149116304 17:53100716-53100738 CTCGAACTTCTCCCTCAAGTTGG - Intergenic
1149679004 17:58491382-58491404 CTCCAGCCTCTTTCTCCTGGAGG - Exonic
1150473862 17:65459760-65459782 CTCCAGCTCCTCCCTGAAGGTGG + Intergenic
1150637015 17:66920121-66920143 CACCACCTTCTCCCTGAAGGAGG + Intergenic
1151328676 17:73394143-73394165 CTCCAGCCTCTCCATCCAAGGGG - Intronic
1151717713 17:75839939-75839961 CTCCACCTGCTCCCCTCAGGCGG - Exonic
1151746517 17:76014564-76014586 CACCACCTTCTCCCTGCAGGAGG + Exonic
1152251791 17:79216333-79216355 CTCCACCTTCTTCCGTCAGGTGG - Intronic
1152532555 17:80927867-80927889 CTCCAGCTCCTCCGTGCGGGCGG - Intronic
1152549158 17:81020798-81020820 TTCCAGCTTGCCCCTCCTGGGGG + Intergenic
1153051161 18:904717-904739 CGCCTGCTTCTTCCTCCGGGTGG + Intergenic
1155351814 18:24914387-24914409 TTCCTGCTTCTCCCTCTTGGAGG + Intergenic
1157392234 18:47312472-47312494 CTCCAGCTCCTTCCTCCATAGGG - Intergenic
1158266000 18:55661386-55661408 CTACAGTTTATCCATCCAGGAGG + Intronic
1160778529 19:867562-867584 CTCCAGCTGCTCTCTGCTGGAGG - Intergenic
1161046840 19:2139604-2139626 CTCCCTCCTCTCCTTCCAGGTGG - Intronic
1161098728 19:2409635-2409657 CTTCATCTCCTCTCTCCAGGAGG - Intronic
1161443707 19:4306242-4306264 GTCCCTCTTCTCCCTCCTGGAGG + Exonic
1163019691 19:14475499-14475521 CCCCAGCGGCTCCCTCCACGAGG + Intergenic
1163436820 19:17301029-17301051 GTCCAGCTGCTCCTTCCAGATGG + Exonic
1163513155 19:17747966-17747988 CCCCGGCTTCCCCCTCCAAGTGG + Intronic
1163727676 19:18932012-18932034 CTCCAGCTGCTGCCTCCACTGGG + Exonic
1164435843 19:28228598-28228620 CCACAGCCTCTCCCTCCAGCCGG + Intergenic
1164633683 19:29777763-29777785 CTCCAGCCACTCCCTCCTGGAGG + Intergenic
1164669893 19:30066549-30066571 CTCCAGCTTCCACCTCCACCAGG - Intergenic
1165994140 19:39832848-39832870 CTCCTCCTTCTCCCATCAGGAGG - Intronic
1166850358 19:45757167-45757189 CACCAGCTTCTGCCTGCAAGAGG - Exonic
1167643853 19:50695443-50695465 CTCCCCCTTCTCCCGCCAAGGGG - Intronic
1167645801 19:50704183-50704205 CTCTACCCCCTCCCTCCAGGTGG - Exonic
1167744455 19:51342363-51342385 CTCCAGCTTCCCCCTGGGGGTGG - Intergenic
1167802494 19:51753706-51753728 CTCCAGCATCCCACACCAGGAGG + Intronic
1168083809 19:54030072-54030094 CTTCACCTCCTACCTCCAGGTGG - Intergenic
1168239018 19:55080118-55080140 CTCCAGCTCCTCCTGCCGGGTGG - Exonic
1168241047 19:55089039-55089061 CACCAGCTTCTCCGACCACGGGG + Intergenic
925221419 2:2144300-2144322 CAGCAGCTTCTCCCTCCTGAAGG - Intronic
925991827 2:9260490-9260512 CTCCAGCTTCTCCCACACAGAGG - Intronic
926226729 2:10972083-10972105 CTCTAGCTTCTGCTCCCAGGAGG + Intergenic
926721716 2:15965964-15965986 CTCCCTCTTCACCCCCCAGGGGG - Intergenic
927089090 2:19696892-19696914 CTACATCTTCACCCTCCAGAGGG + Intergenic
927410356 2:22817917-22817939 CTCAAGATTCTCCCTACAGAGGG + Intergenic
927484105 2:23477239-23477261 CTCCAGCTTCCCTCTGCAGCAGG + Intronic
927674715 2:25096750-25096772 CTCCGTCTTCTCCTGCCAGGAGG - Intronic
928064683 2:28151495-28151517 CTGCAACTTCTGCCTCCTGGTGG - Intronic
929761024 2:44806197-44806219 CTCCACCTTCTCCCTCCCTTCGG - Intergenic
931225061 2:60322320-60322342 CTCCAGCTGCTCCCCCCACAGGG + Intergenic
931448857 2:62350643-62350665 CTCCATCTTCTCCTTCCCAGTGG + Intergenic
931710896 2:64988830-64988852 CGCCGGCCTCTCCCGCCAGGGGG - Intronic
932072000 2:68629841-68629863 CTCCAGCTGGTCCCTCCATTCGG + Intronic
932659638 2:73641218-73641240 CAACCGCTTCTCCCTCAAGGTGG + Exonic
932666201 2:73700895-73700917 CAACCGCTTCTCCCTCAAGGTGG + Intergenic
934298153 2:91759679-91759701 TTCCAGCTTCTGCCACAAGGTGG + Intergenic
934657387 2:96123329-96123351 CTCCAGCCCTTCTCTCCAGGAGG - Intergenic
934770330 2:96903632-96903654 TTCCTGATTCTCCCTCCAGGAGG - Intronic
937441223 2:121917805-121917827 CTCCAGTTTCTTACTCCATGGGG - Intergenic
937460642 2:122082823-122082845 CTCCAGCTTCTTTCTGCAGAAGG - Intergenic
937838409 2:126497812-126497834 CTCCAGCCTGTCCCTCCATTCGG + Intergenic
937900649 2:127016589-127016611 CTGCAGCTTCTCCTCCCACGTGG + Intergenic
939826650 2:147023723-147023745 CTCCAGCTGGTCCCTCCATTTGG + Intergenic
939969708 2:148645142-148645164 CTCCTCCTTCTCCATCCCGGTGG - Exonic
941795423 2:169593759-169593781 CTCCTGCCTCAGCCTCCAGGTGG + Intronic
941806547 2:169716433-169716455 ATCCAGCTTCTCCCTCTCAGAGG + Intronic
942201175 2:173572972-173572994 CTCCAGCCTGAGCCTCCAGGGGG - Intergenic
942244856 2:173998539-173998561 CTCCAGCTCCTCAATCCAGCAGG - Intergenic
942391927 2:175503600-175503622 CTACAGATTGTCCCTCCAGCTGG - Intergenic
944654637 2:201865355-201865377 CTCCACCTTCTCCATCCACCAGG + Intronic
946373481 2:219294678-219294700 CTCCACCTGCTTCCTCCAGAGGG - Intronic
946419682 2:219557826-219557848 CCTCAGCTTCACCGTCCAGGTGG - Exonic
947071303 2:226290976-226290998 CTCCAGCTGGTCCCTCCACATGG - Intergenic
947467078 2:230360789-230360811 CTTCAGCATCTCCCTGAAGGTGG - Intronic
947952657 2:234161439-234161461 CCCCACCCTCTGCCTCCAGGGGG - Intergenic
948382813 2:237562721-237562743 CTGCAACTTCCACCTCCAGGGGG + Intergenic
948459126 2:238120688-238120710 CTCCGTCTTCTCCCTCTGGGAGG + Intronic
948777950 2:240299539-240299561 GCCCATCCTCTCCCTCCAGGGGG + Intergenic
948974602 2:241456765-241456787 CTCAGCCTTCTCCCTCCAGCCGG + Exonic
1168836887 20:883563-883585 CTTCAGTTTCTCCATCCAGAAGG + Intronic
1168924267 20:1566484-1566506 CTCCACCTTTTCCCTCCAGGAGG - Intronic
1168978573 20:1986344-1986366 CTCCAGCTTCTCCCTCCAGGTGG + Intronic
1169161150 20:3379508-3379530 CTGCAGCCTCTGCCTCCTGGTGG - Intronic
1169193256 20:3670725-3670747 CTCCTGCTTCTCCCACCAGCTGG - Intronic
1169324615 20:4665126-4665148 CCACAGCTCCTCCCTCCAGGAGG - Intergenic
1169869244 20:10233642-10233664 CTTCTGCTTCTCTCTCAAGGTGG + Intronic
1170268817 20:14500409-14500431 CTACAGCTGCTCACTCCAGTTGG + Intronic
1171432474 20:25091684-25091706 ATTCAGCTTCTTCCTGCAGGAGG - Intergenic
1173225478 20:41160087-41160109 CTCAGGCTTCTCTCTCCAGGTGG + Exonic
1173530148 20:43763063-43763085 TTCCAGCTACTCCCTCCTGCTGG - Intergenic
1173858651 20:46267924-46267946 GTTCAACTTCTCCCTCCACGTGG - Intronic
1174111450 20:48200786-48200808 CTACAGCATCTCCCACCAGGAGG + Intergenic
1174339822 20:49888670-49888692 CTCTAGCTTTTCCCTCTAGAGGG - Exonic
1175334574 20:58186878-58186900 CTGCAGCTGCTCCATCCAGACGG + Intergenic
1175479106 20:59299368-59299390 CTCCAGGTGATCTCTCCAGGTGG + Intergenic
1175700931 20:61136520-61136542 CAACAGCTTCTCCGCCCAGGCGG - Intergenic
1175842475 20:62038136-62038158 CTCCTGCCTCAGCCTCCAGGTGG + Intronic
1175872630 20:62215745-62215767 CTCCAGACTGTCCCTCCCGGTGG + Exonic
1176238781 20:64066457-64066479 GTCCTCCTTCTCCTTCCAGGAGG + Exonic
1176853215 21:13937283-13937305 CTCTAGGTTCTCCCACCAGCAGG + Intergenic
1176874797 21:14116971-14116993 CTCCAGCAGCTGCCTCCAGAGGG + Intronic
1177604820 21:23364190-23364212 CTCCTGTTTTTCCCTCCAGCTGG - Intergenic
1179068590 21:38050753-38050775 CTCCAGCTTCACCATCCTGGGGG - Intronic
1179641094 21:42747615-42747637 CTCCTGCTTTTCCCTCAAAGAGG + Intronic
1179723650 21:43329995-43330017 CTCCAGCTGCACCCTGGAGGGGG - Intergenic
1179969928 21:44830183-44830205 CTCCAGCGGCTCCCACCATGTGG - Intergenic
1181781697 22:25198396-25198418 CACCACCATCTCCCTCTAGGGGG + Intergenic
1182359832 22:29739957-29739979 CTTAAGCTTCTCTGTCCAGGAGG - Intronic
1182439498 22:30354481-30354503 CTCCAGCTTCACAGTGCAGGAGG - Intronic
1182462129 22:30490563-30490585 CCACAGCTCCTCCCTGCAGGTGG - Intronic
1183259600 22:36785937-36785959 CTGCAGCTTCCCCCTCCACTGGG + Intergenic
1183272085 22:36868588-36868610 CTCCAGCTGCTCCTTCAGGGTGG + Intronic
1183733738 22:39632137-39632159 CTCCTGCTTCTCCCTCGGGCCGG - Intronic
1184226985 22:43134772-43134794 CTCCACCATCACCCTCCATGTGG + Intronic
1185336333 22:50272266-50272288 CACCGGCGGCTCCCTCCAGGGGG - Intergenic
950181299 3:10915305-10915327 CTTCTGCTTCCCCCTCCAGCAGG + Intronic
953008277 3:38998330-38998352 ATCCAGCTTCTTCCTCCAAGAGG - Intergenic
953201509 3:40782023-40782045 AACCAGCTTCTCCATGCAGGTGG + Intergenic
953357096 3:42265084-42265106 CGGCAGCTTCTCCATCCCGGAGG - Intronic
953561131 3:43994931-43994953 CTCCCGCTGCACCCTACAGGAGG + Intergenic
954526621 3:51277589-51277611 CTCTTGCTGCTCGCTCCAGGAGG + Exonic
956805473 3:72806201-72806223 CTCCGGATTCTCCTTCCATGAGG - Intronic
958082229 3:88761251-88761273 CCCCACCTTCACCCTCCAGTAGG + Intergenic
958449746 3:94259010-94259032 CTCCAGCCCCTGCCTCCTGGAGG - Intergenic
959888603 3:111529471-111529493 CTCCAGCTGTTCCCTCCATTCGG - Intronic
960312618 3:116134825-116134847 CCCCAGTGTCTCCCTCTAGGAGG + Intronic
960596140 3:119409789-119409811 CTCCACCTGCTCCAGCCAGGTGG + Intronic
961721855 3:128902534-128902556 CTCCCTGTTCTCCCTGCAGGTGG + Exonic
962082871 3:132159031-132159053 TTGCAGCTTCTCCCACCAAGAGG + Intronic
962359466 3:134725765-134725787 CTCCAGTGTCTCCTTCCAGCAGG + Intronic
963725832 3:148920434-148920456 TTCCAGCTTCTCCCTGGAGAGGG + Intergenic
965390104 3:168094894-168094916 CTCCCGCTTCTTCCTCCCAGCGG - Intronic
967592305 3:191292924-191292946 CTGCACCTTCTGCCTCCTGGGGG - Intronic
968999680 4:3970177-3970199 CTCTGGCTTCTGCCTCCTGGGGG + Intergenic
969451823 4:7278202-7278224 ATGCAGCTCCTCCCACCAGGTGG - Intronic
969860504 4:10032112-10032134 CTCCAGCTCCTCACACCAAGTGG + Intronic
970456198 4:16226492-16226514 CTCCAGCCTCTGCCTCCGGCCGG + Exonic
970714374 4:18904626-18904648 CAGCAGCTTCTCTCTCCAGAGGG - Intergenic
970823543 4:20248318-20248340 CTTCAGCTTCTCATTCCTGGGGG - Intergenic
973264969 4:48201770-48201792 CCCCAGCTTGTCTCTCCAGGTGG - Intronic
973994348 4:56441790-56441812 TTGCAGCTTTTCCTTCCAGGTGG - Exonic
974605817 4:64148053-64148075 CTCCAGCTGGTCCCTCCATTTGG + Intergenic
974788994 4:66661345-66661367 GTCCAGCTTCTCCTTCCAATAGG + Intergenic
975722830 4:77264899-77264921 CTCCAGCTTGTCCCTCCATTTGG + Intronic
976345870 4:84000395-84000417 CTCAAACTTTTCACTCCAGGTGG + Intergenic
978023786 4:103847495-103847517 CTCCAGCTGGTCCCTCCATTTGG - Intergenic
978193830 4:105947456-105947478 CTCCAGCTGGTCCCTCCATTCGG + Intronic
980050260 4:128032651-128032673 CTGCAACCTCTGCCTCCAGGGGG - Intronic
981010502 4:139920748-139920770 CTCCAACTTTTCCTCCCAGGAGG + Intronic
982109558 4:152041392-152041414 CTCCAGCGTCTCCCTCCTGGTGG + Intergenic
982480188 4:155899145-155899167 CTCCAGCTGGTCCCTCCATTTGG + Intronic
982727406 4:158920044-158920066 CTCCAGCTGGTCCCTCCATTCGG - Intronic
984607430 4:181801447-181801469 CTCCAGCTCATTTCTCCAGGTGG + Intergenic
985892504 5:2726557-2726579 GAGCAGCCTCTCCCTCCAGGGGG - Intergenic
985914601 5:2907623-2907645 CTCCAGCCTTGACCTCCAGGTGG - Intergenic
985914620 5:2907689-2907711 CTCCAGCCTTGACCTCCAGGTGG - Intergenic
985914630 5:2907722-2907744 CTCCAGCCTTGACCTCCAGGTGG - Intergenic
985914649 5:2907788-2907810 CTCCAGCCTTGACCTCCAGGTGG - Intergenic
985914659 5:2907821-2907843 CTCCAGCCTTGACCTCCAGGTGG - Intergenic
986105707 5:4657484-4657506 CTCCAGCTACTCCCAGGAGGTGG + Intergenic
986796395 5:11216851-11216873 TCCAAGCTGCTCCCTCCAGGAGG + Intronic
987623422 5:20366524-20366546 CTCCAGCTTCTCCACCATGGTGG - Intronic
988452004 5:31352640-31352662 CTCCAGGATGTCCCTCCACGTGG - Intergenic
990797885 5:59565053-59565075 CCCCAGCTGCACCCTCCTGGTGG - Intronic
991404650 5:66289852-66289874 CACCAGCTTCTCGATCCTGGAGG - Intergenic
994320779 5:98392338-98392360 CTCCAGCAGCTTCCTACAGGTGG + Intergenic
995187468 5:109287282-109287304 CTCCAGCTGGTCCCTCCATTTGG + Intergenic
995561074 5:113382159-113382181 CTCCAGGATCTCCCTTCTGGGGG - Intronic
996737814 5:126773921-126773943 CTCCATCTCCTACCTCCTGGAGG - Intergenic
997362552 5:133304444-133304466 TTCCTGCCTCTCCCTCCAAGAGG + Intronic
997400228 5:133596546-133596568 CTCCAGCTAAGCCCTCCAGAAGG + Intronic
998165786 5:139842754-139842776 TTCCAGCTTCTCCAGCGAGGTGG - Exonic
999596362 5:153209766-153209788 CTCCAGATTCTCCCAGCAAGGGG - Intergenic
1000030726 5:157399002-157399024 CTCCACCTTCTGCCTCCACCAGG + Intronic
1000237995 5:159380817-159380839 CTCCAGCTGGTCCCTCCATTAGG + Intergenic
1001939922 5:175733143-175733165 CTCCACCTTCCTCCTCCACGGGG - Intergenic
1002048009 5:176552901-176552923 ATCCAGCTCTTCCTTCCAGGGGG + Intronic
1002660818 5:180790245-180790267 CTCCTGCTTCTGCCTCCTGCTGG - Intergenic
1003308538 6:4949253-4949275 CTCCAGCTTCACACCCCAGCAGG - Intronic
1003607842 6:7580953-7580975 CTCCAGCTTCTTCCTCTTGCAGG - Exonic
1005349227 6:24918025-24918047 CTCCATCTTCTGTCTCCTGGAGG + Intronic
1006073828 6:31516443-31516465 CCCCAGTTCCACCCTCCAGGGGG + Intergenic
1006292769 6:33152906-33152928 CTCCAGCTGGTCCCTCCATTTGG + Intergenic
1006806491 6:36792727-36792749 CCCCAGCACATCCCTCCAGGAGG + Intronic
1007038366 6:38699173-38699195 CTCCAGCTGGTCCCTCCATTCGG - Intronic
1007169963 6:39856052-39856074 CTCCAGCTCTTCCCACCTGGAGG - Intronic
1007369028 6:41414051-41414073 CACAAGCTGCTCCTTCCAGGAGG + Intergenic
1007630370 6:43269965-43269987 CCCCACCTGCCCCCTCCAGGAGG - Intronic
1007762010 6:44138764-44138786 CTCCACCCCCTCCCTCAAGGTGG - Intronic
1007941495 6:45785696-45785718 CTCCAGCTCCATCCTGCAGGGGG - Intergenic
1008643102 6:53484829-53484851 TTCCAGCATCTCCCTCATGGTGG - Intergenic
1009645191 6:66393462-66393484 CACCATTTTCTCCCTGCAGGTGG - Intergenic
1010776457 6:79891734-79891756 CTCCAGCTGGTCCCTCCATTCGG + Intergenic
1011217688 6:85022413-85022435 ATTCAGCTTCTCCCACCAGTGGG - Intergenic
1011680954 6:89782830-89782852 CTCCAGCTGGTCCCTCCATTTGG - Intronic
1013652095 6:112205813-112205835 CTCCAGCCTCTCCTCCCTGGAGG - Intronic
1013921007 6:115403353-115403375 CTCCAGCTGGTCCCTCCATTTGG + Intergenic
1015204856 6:130624852-130624874 CACCAGCTTATCCCACCAGCAGG - Intergenic
1016773141 6:147874529-147874551 CTCCAGCTCCTGCCACCAGCTGG - Intergenic
1017272720 6:152527945-152527967 CTCCAGCTGTTCCCTCCACAAGG + Intronic
1017565194 6:155676509-155676531 CTTCAGTTTATCACTCCAGGAGG - Intergenic
1017697718 6:157034956-157034978 CCCCAGATTCTATCTCCAGGAGG - Intronic
1019055773 6:169222268-169222290 CTCCGGCGTGTCCCTCAAGGTGG - Exonic
1019282613 7:207938-207960 CTCCAGCTTTGGCCACCAGGAGG - Intronic
1019377143 7:698929-698951 ATTCAGCCTCTCCCTCCTGGAGG + Intronic
1019419707 7:945387-945409 CTCCAGCTGCCCCCTCCACTCGG + Intronic
1019527643 7:1487861-1487883 CTCCTGCTTCTCCCGCTGGGCGG + Exonic
1019734423 7:2643864-2643886 CCCCAGCTCCTCACCCCAGGAGG + Intronic
1019853111 7:3579045-3579067 CTCCAGCTGGTCCCTCCATTTGG + Intronic
1020057701 7:5129623-5129645 CTCCAGCTTCACCCACAGGGCGG + Intergenic
1022482260 7:30752011-30752033 CTTGAGCTTCTCCTTCTAGGGGG - Intronic
1022534325 7:31086365-31086387 CTGGCGCTTCTCCCTGCAGGTGG + Exonic
1023092989 7:36633579-36633601 ATTCCGATTCTCCCTCCAGGTGG - Intronic
1023986924 7:45102210-45102232 CTCCATCCTCTCCCTGTAGGTGG - Intronic
1025912278 7:65838693-65838715 ACCCAGCTGCTGCCTCCAGGTGG + Intergenic
1026266574 7:68800622-68800644 CTCCAGCAGCTCCCTCAAAGGGG + Intergenic
1027274146 7:76541330-76541352 CTCGGGGTACTCCCTCCAGGAGG - Intergenic
1029876512 7:103758818-103758840 CTCCAAATTCTCTCTCCAGTGGG + Intronic
1029979146 7:104861989-104862011 CTGCAGCTTCTCATTCCTGGAGG + Intronic
1030131450 7:106205219-106205241 CTCCAGCTTCCCCTCCCAGGAGG + Intergenic
1030430017 7:109433500-109433522 CCCAAGCTTCTCCCTCAAGTAGG + Intergenic
1032021212 7:128408065-128408087 CCCCAGCTGCTTCCTCCATGGGG + Intronic
1033369904 7:140698118-140698140 CTCCAGATTCTTCATCCATGTGG - Intronic
1033460926 7:141546909-141546931 CTCCTGCCTCAGCCTCCAGGTGG + Intergenic
1033660554 7:143399211-143399233 ATCCAGCCCCTCCCTCCAGATGG + Intronic
1033669545 7:143478031-143478053 CTCCCGCTTCTGCCTGCAGTTGG + Exonic
1034102491 7:148462249-148462271 CTCCAGCTGATCCCTCCATTTGG - Intergenic
1034200470 7:149280485-149280507 CTCCAGCTTCTATCTCCCTGGGG + Intronic
1034381712 7:150701714-150701736 CTCCAGCTTCTGCCTGGAAGGGG + Intergenic
1034505988 7:151491657-151491679 CTGCAGCCTCTGCCTCCTGGGGG - Intronic
1035545018 8:473624-473646 CTCCTGCTTGCCCCTCCAGCTGG - Intergenic
1035567216 8:649681-649703 TTCCAGCTCCTGCCTCCTGGAGG - Intronic
1036487779 8:9195177-9195199 CTCCAGCTTCTACCTCCACTGGG - Intergenic
1037838168 8:22226864-22226886 CTCCACCGTCTCGCTCCAGCCGG + Exonic
1037862008 8:22412071-22412093 CTCCCTCTGCTCCCTCCTGGGGG + Intronic
1038793887 8:30693002-30693024 CTCCAGCTCCTCCGTGCAGTTGG + Exonic
1039474560 8:37832991-37833013 TTCCTGCCTCTCCCCCCAGGTGG + Exonic
1039578609 8:38645691-38645713 CTGCAACCTCTGCCTCCAGGAGG - Intergenic
1039780325 8:40778943-40778965 ATCCAGCTTCTCTAGCCAGGTGG - Intronic
1039820455 8:41129837-41129859 CTCCAGGATCTCCATCAAGGTGG + Intergenic
1040386132 8:46916182-46916204 CCCCAGCTCTTCCCTCCAGCTGG - Intergenic
1040533365 8:48283714-48283736 CTCCTGCTTCTTCTTCCAGCAGG - Intergenic
1040795983 8:51290604-51290626 CTCCAGCTGGTCCCTCCATTTGG + Intergenic
1041004657 8:53486653-53486675 CTGCAGCCCCTCCCCCCAGGGGG - Intergenic
1041010506 8:53538027-53538049 CTCCAGCTGGTCCCTCCATTCGG - Intergenic
1041508633 8:58630043-58630065 CTCTAGCTTCTCCCTGGAGAGGG - Intronic
1042695182 8:71547738-71547760 CGCCGGCTTCTGCCTCCAGTTGG - Intronic
1043145019 8:76642286-76642308 CTCCAGCTGGTCCCTCCATTTGG + Intergenic
1043861674 8:85324529-85324551 CTCCAGCTGGTCCCTCCATTTGG + Intergenic
1045791379 8:105988306-105988328 CTTCAGCTTCTCCCTGCTGAGGG - Intergenic
1047042194 8:121008357-121008379 CTGCAGCTTCTCCATCCTGAAGG + Intergenic
1049512759 8:143038025-143038047 ATCCAGCTTCTCTCTCCTGCTGG - Intergenic
1049905318 9:211271-211293 CTCCAGCTTGTCCCTAAAGCAGG - Intergenic
1049961774 9:744222-744244 CTTCTGCTTCCCCCTCCTGGTGG + Intronic
1050182043 9:2933297-2933319 CTCCCTACTCTCCCTCCAGGGGG - Intergenic
1050253078 9:3766366-3766388 CTCCAAATTCTGCCTCAAGGTGG + Intergenic
1050843843 9:10189268-10189290 CTCCAGCTGCTGGCTGCAGGAGG + Intronic
1052969971 9:34371386-34371408 CTCCTGCTTCTTCCGCCTGGTGG - Exonic
1054814636 9:69463398-69463420 CTCCAAATTCTCTCTCCATGTGG + Intronic
1055051064 9:71981539-71981561 CACCAGCTCCTCCATACAGGTGG - Intronic
1057171642 9:92966527-92966549 CCCCAGCCCCACCCTCCAGGTGG + Intronic
1057194167 9:93107543-93107565 CTGCAGGTTCACCCTCCTGGTGG + Intronic
1059105885 9:111511111-111511133 CTCCAGCTGGTCCCTCCATTTGG - Intergenic
1059329108 9:113524033-113524055 GGTCAGCTCCTCCCTCCAGGCGG + Intronic
1061067121 9:128285486-128285508 CTCCATTCTCTCCCTGCAGGTGG + Intronic
1061383911 9:130276939-130276961 CCCCTGCTTCTCTCTCCAAGTGG - Intergenic
1062186333 9:135220552-135220574 CTCCAGCTCCGCCCCCCAGGTGG - Intergenic
1062347459 9:136121929-136121951 CACGTGCTTCTCCCTACAGGAGG + Intergenic
1062486593 9:136779753-136779775 CTCCAGCTGGTCCCTCCATTCGG + Intergenic
1186922144 X:14293866-14293888 CTCCTGCCTCAGCCTCCAGGTGG + Intergenic
1187942182 X:24392802-24392824 CCCCAGCTTCTCACCCCAAGTGG - Intergenic
1188370145 X:29359794-29359816 CTCCAGCTTTTCCCCCCACACGG + Intronic
1188418957 X:29972972-29972994 CTCTACCTGCTCCCTCCAGGAGG + Intergenic
1188772982 X:34176779-34176801 GTCCAGATTGTCCCTTCAGGTGG - Intergenic
1190759477 X:53427705-53427727 CTCAAGCTGCTCCCTCCACTTGG - Intronic
1190788621 X:53678852-53678874 CACTAGCTTCTTCCACCAGGAGG + Intronic
1192149676 X:68704468-68704490 CTCCAGCCTCTCCTTTCAAGGGG - Intronic
1193980340 X:88174847-88174869 CTCCAGCTGATCCCTCCATTTGG + Intergenic
1195128868 X:101835881-101835903 CTCCAGCTGGTCCCTCCATTTGG + Intronic
1197628571 X:128831755-128831777 CTCCAGCTGGTCCCTCCATTAGG - Intergenic
1198694598 X:139321796-139321818 CTGGAGTTTCTTCCTCCAGGTGG - Intergenic
1198857358 X:141032600-141032622 CTCCAGCCAGTCCCTCCATGCGG + Intergenic
1199107621 X:143889519-143889541 CTCCAGCCTGTCCCTCCATTCGG - Intergenic
1200044309 X:153392924-153392946 CTCCAGCTGCTCCCACCTAGGGG + Intergenic
1201616800 Y:15909470-15909492 CTCCAGCTAGTCCCTCCATTTGG + Intergenic
1201706596 Y:16944289-16944311 CTCCAGCTGGTCCCTCCATTCGG + Intergenic