ID: 1168979202

View in Genome Browser
Species Human (GRCh38)
Location 20:1990599-1990621
Sequence ATTTGCTGTGCAGAGACCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 212}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168979201_1168979202 -4 Left 1168979201 20:1990580-1990602 CCGTTTGGTGGTCGGCTGCATTT 0: 1
1: 0
2: 0
3: 2
4: 79
Right 1168979202 20:1990599-1990621 ATTTGCTGTGCAGAGACCAGAGG 0: 1
1: 0
2: 3
3: 15
4: 212
1168979200_1168979202 -3 Left 1168979200 20:1990579-1990601 CCCGTTTGGTGGTCGGCTGCATT 0: 1
1: 0
2: 0
3: 3
4: 51
Right 1168979202 20:1990599-1990621 ATTTGCTGTGCAGAGACCAGAGG 0: 1
1: 0
2: 3
3: 15
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168979202 Original CRISPR ATTTGCTGTGCAGAGACCAG AGG Intronic
900401229 1:2473758-2473780 CTGTGCTGTGCAGGGACCTGGGG + Intronic
902202782 1:14846030-14846052 GTTTGCTGGGAAGAGCCCAGGGG + Intronic
905123727 1:35702536-35702558 ATTAGCTGTCCAGAGCCTAGGGG + Intergenic
906208476 1:43999454-43999476 ATGTCCTGGGGAGAGACCAGGGG - Intronic
907863020 1:58372067-58372089 TTTTGGGGTGCAGAGAACAGTGG - Intronic
908933271 1:69341854-69341876 ATTTCCTTTGCAGTGTCCAGGGG - Intergenic
908999499 1:70201489-70201511 AGTTGCTGAGCAGAAACAAGTGG + Intronic
910850464 1:91645306-91645328 AGTTGCTGTGCTGCGACGAGAGG + Intergenic
913339797 1:117747316-117747338 ATCTGGTGTGCAGACTCCAGAGG - Intergenic
915363122 1:155297864-155297886 ATTAGCCATGCAGAGACCTGGGG - Intronic
916872624 1:168933327-168933349 ATCTGCTGTTCAGAGCCCAAGGG + Intergenic
920109544 1:203577512-203577534 ATTTGTTCGGCAGAGAGCAGTGG + Intergenic
920160619 1:203995308-203995330 CTTGGCTGTGAGGAGACCAGAGG - Intergenic
920527100 1:206675217-206675239 ATTGGCTCTGCAGACACAAGTGG + Intronic
921810188 1:219503513-219503535 ATTTGATGTGCAGATAAAAGTGG - Intergenic
922462668 1:225825221-225825243 GTTTGCTGTGCAGAGTCCAGGGG + Intronic
1067659558 10:48224206-48224228 CTTTGCTGTGAAGAGAGCAGAGG - Intronic
1070757269 10:79001140-79001162 ATTTGCTGAGCCGAGATAAGCGG - Intergenic
1073176019 10:101558259-101558281 ATTAACTGAGCAGATACCAGTGG - Intergenic
1073937496 10:108651012-108651034 CTCTGATGTGCAGAGACCACGGG - Intergenic
1074563776 10:114558105-114558127 ACTTTCTGTGCAGCGAGCAGCGG + Intronic
1076066973 10:127456390-127456412 ATTTGCCGTGCAGACTCCAGTGG + Intergenic
1077269601 11:1669327-1669349 GCTTTCTGTGCAGAGAGCAGGGG + Intergenic
1077774750 11:5258555-5258577 ATTTGGTGTGCAGACTCCACTGG + Intronic
1079062917 11:17265261-17265283 ATTTGCTGTGGACAGAGAAGAGG + Intronic
1080033548 11:27687948-27687970 GTTGGCTGTGAAGAGAGCAGTGG - Intronic
1080370354 11:31632283-31632305 ATTTGCTGTGCAGAAAATGGTGG + Exonic
1080770815 11:35339582-35339604 ATGTGGTGTGTTGAGACCAGTGG - Intronic
1080894503 11:36438146-36438168 ATTAGCTCTACAGAGACAAGGGG - Intronic
1082796598 11:57382389-57382411 ATCTGGTGAGTAGAGACCAGAGG - Intergenic
1082952723 11:58834689-58834711 ATTTGGTGTGCTGGGTCCAGAGG - Exonic
1082968714 11:58996023-58996045 ATTTGGTGTGCTGGGTCCAGAGG - Intronic
1084493174 11:69489215-69489237 GTCTGCGGTGGAGAGACCAGAGG - Intergenic
1084664084 11:70566819-70566841 ATTTCCTGTTCAGAGACCTTTGG + Intronic
1085917100 11:80903162-80903184 ATCTGGTGTGCAGAGTCCATAGG + Intergenic
1086493551 11:87379507-87379529 AATTGCTTTGCAGAGAGAAGAGG + Intergenic
1090136697 11:124206839-124206861 ATTTGCTCTGCTGAGTCAAGAGG + Intergenic
1090872653 11:130762001-130762023 ATTTGCTGTGGGGAGGCCTGAGG - Intergenic
1093588498 12:20871701-20871723 ATTTGCTTTGGAGAAAGCAGGGG - Intronic
1094368089 12:29705523-29705545 ATTTGCTGTGCAGATTTCAGTGG - Intronic
1095355601 12:41269816-41269838 ACTTGCTATGCACAGACCTGTGG + Intronic
1096844372 12:54397561-54397583 ATTGGATCTGCAGAGCCCAGTGG + Intronic
1097886558 12:64734684-64734706 TTTAGCTGTGCAGAGATCTGTGG - Intronic
1102921795 12:116796990-116797012 ATTTAGTGGACAGAGACCAGGGG + Intronic
1103654067 12:122456491-122456513 ATTTGCTAGGCTGAGAGCAGTGG + Intergenic
1103798179 12:123519579-123519601 ATGTGCTGGGCAGAGGCCAGGGG - Intronic
1105655183 13:22428959-22428981 TTTTGCAATGCTGAGACCAGAGG + Intergenic
1107428656 13:40318687-40318709 TTTTTCTGGGGAGAGACCAGAGG - Intergenic
1109047994 13:57437945-57437967 ATCTGCTGTGCAGACTCCACAGG - Intergenic
1110630710 13:77703414-77703436 ATTTTCAGTGAAAAGACCAGAGG + Intronic
1112746223 13:102530275-102530297 ACTTGCTGAGCAGACTCCAGTGG - Intergenic
1113595474 13:111528742-111528764 ATGGGCTGTCCAGAGGCCAGGGG - Intergenic
1114538586 14:23438417-23438439 ATTTGCTGTGAACACGCCAGCGG + Intergenic
1119857419 14:77910881-77910903 ATCTGCTCTGCACAGACCACTGG - Intronic
1121085537 14:91143446-91143468 GCTTGCTGAGCAGAGACAAGAGG + Intronic
1122740619 14:103869767-103869789 CTGGGCTGTGCAGGGACCAGGGG - Intergenic
1122856526 14:104562884-104562906 ATGTGCTGTGCAGATCCCAGGGG - Intronic
1124221136 15:27850834-27850856 CGTTGCTGTGGAGAGAACAGCGG - Intronic
1124404775 15:29383165-29383187 ATCACCTGTGCAGATACCAGTGG - Intronic
1124407972 15:29408600-29408622 ATAGGCTTTGCAGAGACCAAAGG - Intronic
1127676528 15:61244568-61244590 TTTTGCTATGCAAAGAGCAGGGG + Intergenic
1129156077 15:73718989-73719011 ATTTGATGTGCATATGCCAGTGG + Intergenic
1132965132 16:2649270-2649292 ATTGGATGTGTAGAGAACAGCGG - Intergenic
1133124879 16:3640318-3640340 ATTTGCAGGGCAGAGTCCTGGGG - Intronic
1133145791 16:3785549-3785571 ACCTGCTGTGCAGAGTCCAGGGG + Intronic
1134565527 16:15248704-15248726 CTTTGCTGAGCTGAGACCTGAGG - Intergenic
1134736969 16:16507994-16508016 CTTTGCTGAGCTGAGACCTGAGG + Intergenic
1134930547 16:18204175-18204197 CTTTGCTGAGCTGAGACCTGAGG - Intergenic
1138541229 16:57688969-57688991 ATTGGATGGGCAGAGACCAGGGG - Exonic
1139311519 16:66031984-66032006 CATTGCTGTGCAGAGAGCTGTGG - Intergenic
1140760562 16:78105123-78105145 ATCTGATGGGCAGAGGCCAGTGG + Intronic
1141314240 16:82945631-82945653 ATTTGCTGTGAAGATACCGCAGG + Intronic
1141320979 16:83008618-83008640 CTTTGCTGTGTTGAGACCACTGG + Intronic
1141498239 16:84425132-84425154 CTTTGCTTTGCAGGGGCCAGGGG - Intronic
1141647794 16:85376755-85376777 CTTTGCTGGGCAGAGAGCAGGGG + Intergenic
1142608747 17:1096621-1096643 CTTTCTTGAGCAGAGACCAGAGG - Intronic
1143411518 17:6712386-6712408 ACTGGCTGTGCACAGCCCAGTGG + Intronic
1145950390 17:28812505-28812527 ATTGGCTGTGCAGACAGGAGAGG - Intronic
1146030470 17:29361814-29361836 ATTTGGGGGGCTGAGACCAGAGG + Intergenic
1146427619 17:32757381-32757403 ATTTGGTGGGTAGAGGCCAGGGG + Intronic
1147252493 17:39161425-39161447 CTGGGCAGTGCAGAGACCAGTGG - Intronic
1151409205 17:73910084-73910106 ATTTCCAGAGCAGAGACCACTGG - Intergenic
1151955904 17:77380097-77380119 ATTTGGTCTGCAGAGCCCCGAGG + Intronic
1154342587 18:13516475-13516497 GTGTGCTGTGGAGAGACCTGAGG + Intronic
1155166718 18:23237829-23237851 ATCTCCTCTGCAGACACCAGAGG + Intronic
1156837923 18:41577785-41577807 TTTTGCTTTCCAGAGTCCAGAGG + Intergenic
1159167705 18:64724240-64724262 AGGTGCTGTCCAGAGAACAGAGG + Intergenic
1159880038 18:73850340-73850362 ATATGATGGGCAGAGACCTGGGG + Intergenic
1160257546 18:77259936-77259958 ATTTTCTGTGCTGAGACCTGGGG - Intronic
1160415942 18:78710994-78711016 ACTTTCTTTGCAGAGGCCAGAGG + Intergenic
1160533564 18:79579015-79579037 ATGTCCTGTGCACAGGCCAGGGG + Intergenic
1161577952 19:5065157-5065179 GCCTGCTTTGCAGAGACCAGTGG + Intronic
926324980 2:11777690-11777712 ATTTTCTGTAAAGAGCCCAGTGG - Intronic
927957359 2:27217264-27217286 TTTTGCAGTGCGGAGACCACGGG + Intergenic
928081280 2:28314824-28314846 ATTTGATGTGCAGAGAGGGGAGG + Intronic
930733950 2:54756144-54756166 ATTTGCAGTGCAGAGCCCAGAGG - Intronic
942483637 2:176416489-176416511 ATTTGTTGTGTAGAAACCTGAGG + Intergenic
943129633 2:183839699-183839721 ATCTGGTGTGCAGAGTCCACAGG + Intergenic
943301762 2:186211629-186211651 ATGTGCTGTTCATAGTCCAGAGG - Intergenic
943711868 2:191105976-191105998 ATTTGCTGTGAAGACGACAGGGG + Intronic
943786829 2:191886522-191886544 CTTGGCTGTGCAGAGTCCTGAGG - Intergenic
944504981 2:200401954-200401976 ATTTCCTGAGAAGGGACCAGTGG - Intronic
947735682 2:232453983-232454005 ATTTCCTGTGGAGGGACCACAGG + Intergenic
947850809 2:233286275-233286297 ATAGTCTGTGCAGAGCCCAGTGG + Intronic
948447480 2:238044088-238044110 ATTTGCAGAGCACAGACCACAGG + Intronic
1168979202 20:1990599-1990621 ATTTGCTGTGCAGAGACCAGAGG + Intronic
1171170692 20:23012649-23012671 ATTCTCTGAGCAGAGACCATTGG - Intergenic
1172453469 20:35046663-35046685 ATTTGCTGTGCAGGGGGCATTGG + Intronic
1173177005 20:40772025-40772047 ATTTGCTTTGAGGAGTCCAGAGG + Intergenic
1173315162 20:41936616-41936638 ATCAGCTGAGCAGAGCCCAGTGG + Intergenic
1173664289 20:44753908-44753930 AAAGGCTGTGCAGACACCAGGGG + Intronic
1174777794 20:53361701-53361723 ATTTGGTGGTCAGAGGCCAGAGG + Intronic
1175825624 20:61934998-61935020 CTTTGCGGTGAAGAGAACAGAGG + Intronic
1175982075 20:62743638-62743660 TTTTGCTTTGCAGAACCCAGAGG - Intronic
1177847164 21:26303609-26303631 ATTTGATGTGTATAGAGCAGAGG + Intergenic
1177932987 21:27308245-27308267 CTTATCTGTGCAGAGAGCAGTGG - Intergenic
1178113071 21:29389034-29389056 TTTAGCTGCGCAAAGACCAGAGG + Intronic
1179351739 21:40617652-40617674 ATTTAGTGTGCAAGGACCAGGGG - Intronic
1179376148 21:40851387-40851409 GTTTGCAGTTCTGAGACCAGAGG - Intergenic
1182018610 22:27061936-27061958 ATTGGCTGGGTTGAGACCAGAGG - Intergenic
1182564543 22:31187530-31187552 ACTTGCTGTGCTGAGCCTAGAGG + Intronic
1182972638 22:34592223-34592245 ATTTGCTGGGGAGTGACCATGGG - Intergenic
1183331212 22:37222651-37222673 ATTTGCAGAGCAGAAACAAGTGG + Intergenic
1183786512 22:40032059-40032081 AGCTGCTGTGCAGGGACCAAGGG - Exonic
1185000913 22:48244978-48245000 ATTTGCTTTGCAAAGGACAGAGG - Intergenic
949841499 3:8325098-8325120 TTTTGATGTGAAGTGACCAGAGG - Intergenic
950345563 3:12288611-12288633 GTTCGCTGTCCAGAGCCCAGGGG + Intronic
951467689 3:23020091-23020113 ATTTCCTGGGCAGAATCCAGGGG + Intergenic
951849218 3:27119951-27119973 ATTTTCTGTGCAGAGACATAGGG - Intronic
953642611 3:44723383-44723405 TGTTGGTGTACAGAGACCAGAGG + Exonic
954030569 3:47817159-47817181 ATTTACTGTACTGAAACCAGAGG + Intronic
955727968 3:61952909-61952931 ATTTTCTGTGTAGACAACAGTGG - Intronic
956093867 3:65695740-65695762 ATTTGCTGTGCAGATTCCAAGGG + Intronic
958085231 3:88797891-88797913 AGTTGCTGTCCAGAAGCCAGGGG + Intergenic
963758378 3:149259431-149259453 ATGTGCTGTCCAGGGACCTGGGG + Intergenic
968731881 4:2273012-2273034 ATTTGGAGTGCAGAGGTCAGGGG + Intronic
969115475 4:4868351-4868373 CTCTGCTGTGCTGACACCAGAGG + Intergenic
971926308 4:33013490-33013512 AGTTGCTGTGCAGGGATTAGGGG + Intergenic
972202005 4:36724398-36724420 AAAAGCTGTGCAGAGGCCAGTGG - Intergenic
973363853 4:49191122-49191144 ATTTGTTGTGATGAGACCTGGGG - Intergenic
973397227 4:49605616-49605638 ATTTGTTGTGATGAGACCTGGGG + Intergenic
973990970 4:56406762-56406784 ATTGGCTGGGCAGAGAAGAGAGG - Intronic
974521534 4:62987191-62987213 ATTTGCTGTGCTGTGGGCAGTGG - Intergenic
975321930 4:73018678-73018700 CTTTGCGGTGCAGAGGCCTGAGG + Intergenic
975433351 4:74321010-74321032 ATTTGCAGAGCATAGAGCAGTGG - Intergenic
975928786 4:79492381-79492403 TTTTCCTGGGCAGAGTCCAGGGG - Intergenic
977046955 4:92079586-92079608 ATTAGCTCTGAAGAGAGCAGTGG + Intergenic
977151717 4:93520902-93520924 AGATGCTGTGTGGAGACCAGGGG + Intronic
979844375 4:125490057-125490079 ATTTGCTGTGCATTAATCAGTGG + Exonic
980636713 4:135515375-135515397 AGTTGCTGTGCAGAAACCACAGG + Intergenic
985286418 4:188340688-188340710 ATGTACTGTGCAGTGAGCAGGGG + Intergenic
1202761165 4_GL000008v2_random:112218-112240 ATTTGTTGTGATGAGACCTGGGG - Intergenic
987044922 5:14099040-14099062 ATTTGGCTTGCAGAGACAAGAGG - Intergenic
989047447 5:37286596-37286618 ATTGGCTATGCAGACAGCAGTGG - Intergenic
989762163 5:45028960-45028982 ATTTACTTTGCACAGATCAGAGG - Intergenic
992091856 5:73324540-73324562 AATTACTGTGCACAGCCCAGAGG - Intergenic
994502130 5:100592415-100592437 ATTGCCAGTGCAGAAACCAGAGG + Intergenic
994683124 5:102914643-102914665 ATTTGCTTTGCAGAGACATTAGG - Intronic
995339148 5:111037363-111037385 CTTTGCTGTGCAGAAACTACTGG + Intergenic
996008244 5:118449723-118449745 ATTTGCTATGCAGAGGGGAGTGG - Intergenic
997283300 5:132661892-132661914 AGCTGGAGTGCAGAGACCAGCGG + Intergenic
997513431 5:134468141-134468163 ATGTTCTCTGCAGAGACCATGGG - Intergenic
1000160461 5:158592355-158592377 CTTTGCTTTGCTGAGACCACAGG - Intergenic
1001717394 5:173827743-173827765 ACTTTCTGTCCAGAGAGCAGAGG + Intergenic
1002969338 6:1997724-1997746 ATTTGGTGAGCAGAGACCCCTGG + Intronic
1003585839 6:7388555-7388577 ATTTGCTGTGTAGACAGCACTGG - Intronic
1004162050 6:13222768-13222790 ATCTGGTGGGCAGAGGCCAGGGG + Intronic
1007017660 6:38485338-38485360 ATTTGCTTTGCCCAGATCAGAGG + Intronic
1007119394 6:39367645-39367667 ATTAGCCGTGCAAGGACCAGAGG + Intronic
1010520897 6:76835307-76835329 ATTTGGTGTATAGAGGCCAGGGG + Intergenic
1010633727 6:78231298-78231320 ATCTGGTGTGCAGAGTCCACAGG - Intergenic
1010801938 6:80186604-80186626 TTTTCCTGAGCAGAGTCCAGGGG - Intronic
1013164864 6:107580663-107580685 ATTTGTTGGGCAAAGACCAGAGG + Intronic
1014353070 6:120368026-120368048 TTTTGCTGTGCAGAAACAAAGGG - Intergenic
1015085064 6:129280834-129280856 ATTTCCAGTGCTGAAACCAGAGG - Intronic
1015465411 6:133543335-133543357 GGTAGCTGTGCAGAGAACAGAGG + Intergenic
1015678317 6:135775979-135776001 AATTGCTGCACAGAGAACAGGGG - Intergenic
1018221244 6:161581872-161581894 ATTTACTGCGCAGAGAGCTGAGG + Intronic
1018936086 6:168274814-168274836 ATTTGCACCTCAGAGACCAGGGG + Intergenic
1019498651 7:1353143-1353165 GTCTGCTGTTCAGAGCCCAGTGG - Intergenic
1019815322 7:3195748-3195770 ATTCCCTGTGCAGAGACAATGGG + Intergenic
1020450425 7:8315330-8315352 ATTTGCTGCTTAGAGACTAGAGG - Intergenic
1020451607 7:8326065-8326087 CTTTGAAGTGCAGACACCAGAGG - Intergenic
1020930317 7:14384812-14384834 ATTTGATAGGCAGAGGCCAGGGG + Intronic
1021964791 7:25906813-25906835 ATTTTCTGTGCAGAGGCCTGCGG - Intergenic
1022752337 7:33242978-33243000 ATTTACTGTGGAGAGACCTAAGG - Intronic
1026425945 7:70293844-70293866 ATTTGCATTGGAGTGACCAGTGG + Intronic
1031178301 7:118380696-118380718 CTTTACTGTGGGGAGACCAGAGG + Intergenic
1033523046 7:142181830-142181852 ATTTGCTGTGCAGAAAATACTGG - Intronic
1034756847 7:153630074-153630096 ATTCCCTGTGCAGTGACCACTGG - Intergenic
1037839161 8:22231802-22231824 TTTTCCTCTGCAGAGCCCAGTGG - Exonic
1039580855 8:38665931-38665953 CTTGGCTGTGCACAGACCACAGG - Intergenic
1039953712 8:42191410-42191432 ATTTCCTGCGAAGAAACCAGAGG + Exonic
1041218648 8:55626886-55626908 ATTTGCTGGCAAGAGCCCAGAGG + Intergenic
1042781429 8:72495247-72495269 GTCTGCTATGCAAAGACCAGGGG - Intergenic
1043539263 8:81240956-81240978 ATTTCCTTTGTAGAGAACAGGGG - Intergenic
1044355623 8:91219645-91219667 GTGTGCTTTGCACAGACCAGTGG + Intronic
1044422181 8:92009629-92009651 ATTTCCTGTGCAAATACCACTGG - Intronic
1044591317 8:93916853-93916875 ATTGGCTGCGCAGTGACGAGTGG - Intronic
1047033559 8:120910654-120910676 ATTTGGTGTGGAGAGAAGAGAGG - Intergenic
1048865864 8:138761074-138761096 CTTTGCTGTTCAGAGTACAGAGG - Intronic
1049511029 8:143026759-143026781 GTTTTCTGTGCAGGGAGCAGAGG + Intergenic
1053073345 9:35114153-35114175 GTTTGCTGTGCTGAGACTGGAGG - Intronic
1054858054 9:69922701-69922723 ATTTGCTGTGGTGAGATCACAGG - Intergenic
1054886617 9:70205617-70205639 AGTTGCTGTGCAAAGAACAGAGG + Intronic
1054972265 9:71101982-71102004 ATTTGGTGTTCAGAGCACAGAGG - Intronic
1056666318 9:88583473-88583495 AGATGCTGACCAGAGACCAGCGG - Intronic
1057216546 9:93231814-93231836 AGCTTCTTTGCAGAGACCAGGGG + Intronic
1059562678 9:115350638-115350660 GTTTGCTGTGCAGAAAGAAGAGG + Intronic
1060148429 9:121270910-121270932 ATTTGCTTATCAGAGACCACAGG + Intronic
1060269178 9:122128850-122128872 AAGTGCTGGGCAGAGGCCAGAGG + Intergenic
1060606112 9:124915560-124915582 ATTTATGGTGCTGAGACCAGTGG + Intronic
1203541934 Un_KI270743v1:97099-97121 ATTTGTTGTGATGAGACCTGGGG - Intergenic
1186359192 X:8821749-8821771 GATTGTTCTGCAGAGACCAGAGG + Intergenic
1186441149 X:9587675-9587697 ATTTGCAGTGCACAGTTCAGAGG + Intronic
1186699865 X:12078777-12078799 ATGTGGTGTGCAGAGGCCAGGGG - Intergenic
1188679599 X:32985701-32985723 AGTTGCTGTGGAAAAACCAGAGG + Intronic
1190725758 X:53189655-53189677 CTTTGCATTGCAGAGTCCAGTGG - Intergenic
1191695561 X:63986155-63986177 ATGTGCTGTGTACTGACCAGCGG + Intergenic
1192018509 X:67358337-67358359 ACTGGCTCTGCAGAGAGCAGCGG + Intergenic
1192498486 X:71632714-71632736 ATATTCTGTAGAGAGACCAGGGG - Intergenic
1194219563 X:91174834-91174856 ATATGCTGTCCGGAAACCAGGGG + Intergenic
1194262636 X:91716343-91716365 TTTTCCTGAGCAGAGTCCAGGGG + Intergenic
1195064640 X:101229943-101229965 ATTTGCTGTGTAGGGAATAGGGG - Intronic
1198338583 X:135692163-135692185 AGCTGCAGTGCACAGACCAGAGG + Intergenic
1198408327 X:136339102-136339124 CTTTCCTGTCCAGAGACTAGCGG - Intronic
1198438672 X:136640792-136640814 AGGTGCTGTGCAGAGACCAGAGG + Intergenic
1198741584 X:139848734-139848756 ATATGGTGTTCAGAGATCAGAGG - Intronic
1200008244 X:153102193-153102215 ATTTGGGGAGCAGAGACCTGAGG + Intergenic
1200556075 Y:4638598-4638620 ATATGCTGTCCGGAAACCAGGGG + Intergenic
1201628021 Y:16036394-16036416 ATGTGCTCTCCAGAGACCTGGGG - Intergenic