ID: 1168979202

View in Genome Browser
Species Human (GRCh38)
Location 20:1990599-1990621
Sequence ATTTGCTGTGCAGAGACCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168979200_1168979202 -3 Left 1168979200 20:1990579-1990601 CCCGTTTGGTGGTCGGCTGCATT No data
Right 1168979202 20:1990599-1990621 ATTTGCTGTGCAGAGACCAGAGG No data
1168979201_1168979202 -4 Left 1168979201 20:1990580-1990602 CCGTTTGGTGGTCGGCTGCATTT No data
Right 1168979202 20:1990599-1990621 ATTTGCTGTGCAGAGACCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168979202 Original CRISPR ATTTGCTGTGCAGAGACCAG AGG Intronic