ID: 1168982117

View in Genome Browser
Species Human (GRCh38)
Location 20:2014109-2014131
Sequence CACACCTCCAACTCTAATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168982117_1168982119 4 Left 1168982117 20:2014109-2014131 CCACAATTAGAGTTGGAGGTGTG No data
Right 1168982119 20:2014136-2014158 CTACTCACTCAGGAGCTGACAGG No data
1168982117_1168982118 -6 Left 1168982117 20:2014109-2014131 CCACAATTAGAGTTGGAGGTGTG No data
Right 1168982118 20:2014126-2014148 GGTGTGAACGCTACTCACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168982117 Original CRISPR CACACCTCCAACTCTAATTG TGG (reversed) Intergenic
No off target data available for this crispr