ID: 1168984058

View in Genome Browser
Species Human (GRCh38)
Location 20:2032482-2032504
Sequence GCTCTTGGAGGCGGGGTCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168984050_1168984058 -2 Left 1168984050 20:2032461-2032483 CCTCTGCCTCATTGTGTGCCTGC No data
Right 1168984058 20:2032482-2032504 GCTCTTGGAGGCGGGGTCTTTGG No data
1168984051_1168984058 -8 Left 1168984051 20:2032467-2032489 CCTCATTGTGTGCCTGCTCTTGG No data
Right 1168984058 20:2032482-2032504 GCTCTTGGAGGCGGGGTCTTTGG No data
1168984049_1168984058 21 Left 1168984049 20:2032438-2032460 CCTAATGCAAAGCTGAAAATTCT No data
Right 1168984058 20:2032482-2032504 GCTCTTGGAGGCGGGGTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168984058 Original CRISPR GCTCTTGGAGGCGGGGTCTT TGG Intergenic