ID: 1168984860

View in Genome Browser
Species Human (GRCh38)
Location 20:2039315-2039337
Sequence GGGCCGGTTGTTGAGTCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168984860_1168984869 2 Left 1168984860 20:2039315-2039337 CCAGCAGACTCAACAACCGGCCC No data
Right 1168984869 20:2039340-2039362 CCATCTGTAAACGTGGGGGCAGG No data
1168984860_1168984870 3 Left 1168984860 20:2039315-2039337 CCAGCAGACTCAACAACCGGCCC No data
Right 1168984870 20:2039341-2039363 CATCTGTAAACGTGGGGGCAGGG No data
1168984860_1168984875 27 Left 1168984860 20:2039315-2039337 CCAGCAGACTCAACAACCGGCCC No data
Right 1168984875 20:2039365-2039387 GCTTCAGACTTGGTGACCAAGGG No data
1168984860_1168984871 4 Left 1168984860 20:2039315-2039337 CCAGCAGACTCAACAACCGGCCC No data
Right 1168984871 20:2039342-2039364 ATCTGTAAACGTGGGGGCAGGGG No data
1168984860_1168984865 -3 Left 1168984860 20:2039315-2039337 CCAGCAGACTCAACAACCGGCCC No data
Right 1168984865 20:2039335-2039357 CCCAGCCATCTGTAAACGTGGGG No data
1168984860_1168984876 30 Left 1168984860 20:2039315-2039337 CCAGCAGACTCAACAACCGGCCC No data
Right 1168984876 20:2039368-2039390 TCAGACTTGGTGACCAAGGGAGG No data
1168984860_1168984863 -4 Left 1168984860 20:2039315-2039337 CCAGCAGACTCAACAACCGGCCC No data
Right 1168984863 20:2039334-2039356 GCCCAGCCATCTGTAAACGTGGG No data
1168984860_1168984867 -2 Left 1168984860 20:2039315-2039337 CCAGCAGACTCAACAACCGGCCC No data
Right 1168984867 20:2039336-2039358 CCAGCCATCTGTAAACGTGGGGG No data
1168984860_1168984862 -5 Left 1168984860 20:2039315-2039337 CCAGCAGACTCAACAACCGGCCC No data
Right 1168984862 20:2039333-2039355 GGCCCAGCCATCTGTAAACGTGG No data
1168984860_1168984873 17 Left 1168984860 20:2039315-2039337 CCAGCAGACTCAACAACCGGCCC No data
Right 1168984873 20:2039355-2039377 GGGGCAGGGGGCTTCAGACTTGG No data
1168984860_1168984874 26 Left 1168984860 20:2039315-2039337 CCAGCAGACTCAACAACCGGCCC No data
Right 1168984874 20:2039364-2039386 GGCTTCAGACTTGGTGACCAAGG No data
1168984860_1168984872 5 Left 1168984860 20:2039315-2039337 CCAGCAGACTCAACAACCGGCCC No data
Right 1168984872 20:2039343-2039365 TCTGTAAACGTGGGGGCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168984860 Original CRISPR GGGCCGGTTGTTGAGTCTGC TGG (reversed) Intergenic
No off target data available for this crispr