ID: 1168985586

View in Genome Browser
Species Human (GRCh38)
Location 20:2045812-2045834
Sequence CAAATTGGGTAGTAGAGGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168985579_1168985586 16 Left 1168985579 20:2045773-2045795 CCCAACTAACTGAGGCTCTGTTG No data
Right 1168985586 20:2045812-2045834 CAAATTGGGTAGTAGAGGCTAGG No data
1168985580_1168985586 15 Left 1168985580 20:2045774-2045796 CCAACTAACTGAGGCTCTGTTGG No data
Right 1168985586 20:2045812-2045834 CAAATTGGGTAGTAGAGGCTAGG No data
1168985578_1168985586 17 Left 1168985578 20:2045772-2045794 CCCCAACTAACTGAGGCTCTGTT No data
Right 1168985586 20:2045812-2045834 CAAATTGGGTAGTAGAGGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168985586 Original CRISPR CAAATTGGGTAGTAGAGGCT AGG Intergenic
No off target data available for this crispr