ID: 1168986377

View in Genome Browser
Species Human (GRCh38)
Location 20:2052526-2052548
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168986377_1168986384 10 Left 1168986377 20:2052526-2052548 CCCAAATTGGGCCATGATGACCA No data
Right 1168986384 20:2052559-2052581 CTCCTATATCAGTCAGTCTTCGG No data
1168986377_1168986386 26 Left 1168986377 20:2052526-2052548 CCCAAATTGGGCCATGATGACCA No data
Right 1168986386 20:2052575-2052597 TCTTCGGATACGAGCCACCATGG No data
1168986377_1168986387 27 Left 1168986377 20:2052526-2052548 CCCAAATTGGGCCATGATGACCA No data
Right 1168986387 20:2052576-2052598 CTTCGGATACGAGCCACCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168986377 Original CRISPR TGGTCATCATGGCCCAATTT GGG (reversed) Intergenic