ID: 1168986378 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 20:2052527-2052549 |
| Sequence | CTGGTCATCATGGCCCAATT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1168986378_1168986387 | 26 | Left | 1168986378 | 20:2052527-2052549 | CCAAATTGGGCCATGATGACCAG | No data | ||
| Right | 1168986387 | 20:2052576-2052598 | CTTCGGATACGAGCCACCATGGG | No data | ||||
| 1168986378_1168986386 | 25 | Left | 1168986378 | 20:2052527-2052549 | CCAAATTGGGCCATGATGACCAG | No data | ||
| Right | 1168986386 | 20:2052575-2052597 | TCTTCGGATACGAGCCACCATGG | No data | ||||
| 1168986378_1168986384 | 9 | Left | 1168986378 | 20:2052527-2052549 | CCAAATTGGGCCATGATGACCAG | No data | ||
| Right | 1168986384 | 20:2052559-2052581 | CTCCTATATCAGTCAGTCTTCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1168986378 | Original CRISPR | CTGGTCATCATGGCCCAATT TGG (reversed) | Intergenic | ||