ID: 1168986380

View in Genome Browser
Species Human (GRCh38)
Location 20:2052537-2052559
Sequence GCATAAGGGCCTGGTCATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168986380_1168986384 -1 Left 1168986380 20:2052537-2052559 CCATGATGACCAGGCCCTTATGC No data
Right 1168986384 20:2052559-2052581 CTCCTATATCAGTCAGTCTTCGG No data
1168986380_1168986387 16 Left 1168986380 20:2052537-2052559 CCATGATGACCAGGCCCTTATGC No data
Right 1168986387 20:2052576-2052598 CTTCGGATACGAGCCACCATGGG No data
1168986380_1168986386 15 Left 1168986380 20:2052537-2052559 CCATGATGACCAGGCCCTTATGC No data
Right 1168986386 20:2052575-2052597 TCTTCGGATACGAGCCACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168986380 Original CRISPR GCATAAGGGCCTGGTCATCA TGG (reversed) Intergenic