ID: 1168986381

View in Genome Browser
Species Human (GRCh38)
Location 20:2052546-2052568
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168986381_1168986387 7 Left 1168986381 20:2052546-2052568 CCAGGCCCTTATGCTCCTATATC No data
Right 1168986387 20:2052576-2052598 CTTCGGATACGAGCCACCATGGG No data
1168986381_1168986386 6 Left 1168986381 20:2052546-2052568 CCAGGCCCTTATGCTCCTATATC No data
Right 1168986386 20:2052575-2052597 TCTTCGGATACGAGCCACCATGG No data
1168986381_1168986390 23 Left 1168986381 20:2052546-2052568 CCAGGCCCTTATGCTCCTATATC No data
Right 1168986390 20:2052592-2052614 CCATGGGAAGATTAAAACCTTGG No data
1168986381_1168986384 -10 Left 1168986381 20:2052546-2052568 CCAGGCCCTTATGCTCCTATATC No data
Right 1168986384 20:2052559-2052581 CTCCTATATCAGTCAGTCTTCGG No data
1168986381_1168986391 24 Left 1168986381 20:2052546-2052568 CCAGGCCCTTATGCTCCTATATC No data
Right 1168986391 20:2052593-2052615 CATGGGAAGATTAAAACCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168986381 Original CRISPR GATATAGGAGCATAAGGGCC TGG (reversed) Intergenic