ID: 1168986382

View in Genome Browser
Species Human (GRCh38)
Location 20:2052551-2052573
Sequence TGACTGATATAGGAGCATAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 124}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168986382_1168986386 1 Left 1168986382 20:2052551-2052573 CCCTTATGCTCCTATATCAGTCA 0: 1
1: 0
2: 1
3: 8
4: 124
Right 1168986386 20:2052575-2052597 TCTTCGGATACGAGCCACCATGG No data
1168986382_1168986390 18 Left 1168986382 20:2052551-2052573 CCCTTATGCTCCTATATCAGTCA 0: 1
1: 0
2: 1
3: 8
4: 124
Right 1168986390 20:2052592-2052614 CCATGGGAAGATTAAAACCTTGG No data
1168986382_1168986391 19 Left 1168986382 20:2052551-2052573 CCCTTATGCTCCTATATCAGTCA 0: 1
1: 0
2: 1
3: 8
4: 124
Right 1168986391 20:2052593-2052615 CATGGGAAGATTAAAACCTTGGG No data
1168986382_1168986387 2 Left 1168986382 20:2052551-2052573 CCCTTATGCTCCTATATCAGTCA 0: 1
1: 0
2: 1
3: 8
4: 124
Right 1168986387 20:2052576-2052598 CTTCGGATACGAGCCACCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168986382 Original CRISPR TGACTGATATAGGAGCATAA GGG (reversed) Intergenic