ID: 1168986384

View in Genome Browser
Species Human (GRCh38)
Location 20:2052559-2052581
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168986374_1168986384 23 Left 1168986374 20:2052513-2052535 CCTTCAATCTTGTCCCAAATTGG No data
Right 1168986384 20:2052559-2052581 CTCCTATATCAGTCAGTCTTCGG No data
1168986380_1168986384 -1 Left 1168986380 20:2052537-2052559 CCATGATGACCAGGCCCTTATGC No data
Right 1168986384 20:2052559-2052581 CTCCTATATCAGTCAGTCTTCGG No data
1168986378_1168986384 9 Left 1168986378 20:2052527-2052549 CCAAATTGGGCCATGATGACCAG No data
Right 1168986384 20:2052559-2052581 CTCCTATATCAGTCAGTCTTCGG No data
1168986381_1168986384 -10 Left 1168986381 20:2052546-2052568 CCAGGCCCTTATGCTCCTATATC No data
Right 1168986384 20:2052559-2052581 CTCCTATATCAGTCAGTCTTCGG No data
1168986377_1168986384 10 Left 1168986377 20:2052526-2052548 CCCAAATTGGGCCATGATGACCA No data
Right 1168986384 20:2052559-2052581 CTCCTATATCAGTCAGTCTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168986384 Original CRISPR CTCCTATATCAGTCAGTCTT CGG Intergenic