ID: 1168986385

View in Genome Browser
Species Human (GRCh38)
Location 20:2052561-2052583
Sequence ATCCGAAGACTGACTGATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168986385_1168986391 9 Left 1168986385 20:2052561-2052583 CCTATATCAGTCAGTCTTCGGAT No data
Right 1168986391 20:2052593-2052615 CATGGGAAGATTAAAACCTTGGG No data
1168986385_1168986387 -8 Left 1168986385 20:2052561-2052583 CCTATATCAGTCAGTCTTCGGAT No data
Right 1168986387 20:2052576-2052598 CTTCGGATACGAGCCACCATGGG No data
1168986385_1168986386 -9 Left 1168986385 20:2052561-2052583 CCTATATCAGTCAGTCTTCGGAT No data
Right 1168986386 20:2052575-2052597 TCTTCGGATACGAGCCACCATGG No data
1168986385_1168986390 8 Left 1168986385 20:2052561-2052583 CCTATATCAGTCAGTCTTCGGAT No data
Right 1168986390 20:2052592-2052614 CCATGGGAAGATTAAAACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168986385 Original CRISPR ATCCGAAGACTGACTGATAT AGG (reversed) Intergenic