ID: 1168986387

View in Genome Browser
Species Human (GRCh38)
Location 20:2052576-2052598
Sequence CTTCGGATACGAGCCACCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168986381_1168986387 7 Left 1168986381 20:2052546-2052568 CCAGGCCCTTATGCTCCTATATC No data
Right 1168986387 20:2052576-2052598 CTTCGGATACGAGCCACCATGGG No data
1168986377_1168986387 27 Left 1168986377 20:2052526-2052548 CCCAAATTGGGCCATGATGACCA No data
Right 1168986387 20:2052576-2052598 CTTCGGATACGAGCCACCATGGG No data
1168986383_1168986387 1 Left 1168986383 20:2052552-2052574 CCTTATGCTCCTATATCAGTCAG No data
Right 1168986387 20:2052576-2052598 CTTCGGATACGAGCCACCATGGG No data
1168986378_1168986387 26 Left 1168986378 20:2052527-2052549 CCAAATTGGGCCATGATGACCAG No data
Right 1168986387 20:2052576-2052598 CTTCGGATACGAGCCACCATGGG No data
1168986385_1168986387 -8 Left 1168986385 20:2052561-2052583 CCTATATCAGTCAGTCTTCGGAT No data
Right 1168986387 20:2052576-2052598 CTTCGGATACGAGCCACCATGGG No data
1168986380_1168986387 16 Left 1168986380 20:2052537-2052559 CCATGATGACCAGGCCCTTATGC No data
Right 1168986387 20:2052576-2052598 CTTCGGATACGAGCCACCATGGG No data
1168986382_1168986387 2 Left 1168986382 20:2052551-2052573 CCCTTATGCTCCTATATCAGTCA 0: 1
1: 0
2: 1
3: 8
4: 124
Right 1168986387 20:2052576-2052598 CTTCGGATACGAGCCACCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168986387 Original CRISPR CTTCGGATACGAGCCACCAT GGG Intergenic