ID: 1168986390

View in Genome Browser
Species Human (GRCh38)
Location 20:2052592-2052614
Sequence CCATGGGAAGATTAAAACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168986381_1168986390 23 Left 1168986381 20:2052546-2052568 CCAGGCCCTTATGCTCCTATATC No data
Right 1168986390 20:2052592-2052614 CCATGGGAAGATTAAAACCTTGG No data
1168986383_1168986390 17 Left 1168986383 20:2052552-2052574 CCTTATGCTCCTATATCAGTCAG No data
Right 1168986390 20:2052592-2052614 CCATGGGAAGATTAAAACCTTGG No data
1168986382_1168986390 18 Left 1168986382 20:2052551-2052573 CCCTTATGCTCCTATATCAGTCA 0: 1
1: 0
2: 1
3: 8
4: 124
Right 1168986390 20:2052592-2052614 CCATGGGAAGATTAAAACCTTGG No data
1168986385_1168986390 8 Left 1168986385 20:2052561-2052583 CCTATATCAGTCAGTCTTCGGAT No data
Right 1168986390 20:2052592-2052614 CCATGGGAAGATTAAAACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168986390 Original CRISPR CCATGGGAAGATTAAAACCT TGG Intergenic