ID: 1168991885

View in Genome Browser
Species Human (GRCh38)
Location 20:2102655-2102677
Sequence CCGTCTTAAAGGGGCCGCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 31}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168991868_1168991885 13 Left 1168991868 20:2102619-2102641 CCCTCCCCTCCCCCGTTCAATCA 0: 1
1: 0
2: 2
3: 89
4: 2576
Right 1168991885 20:2102655-2102677 CCGTCTTAAAGGGGCCGCGGCGG 0: 1
1: 0
2: 0
3: 3
4: 31
1168991879_1168991885 1 Left 1168991879 20:2102631-2102653 CCGTTCAATCAGCGGCGGTGGCT 0: 1
1: 0
2: 0
3: 2
4: 49
Right 1168991885 20:2102655-2102677 CCGTCTTAAAGGGGCCGCGGCGG 0: 1
1: 0
2: 0
3: 3
4: 31
1168991873_1168991885 7 Left 1168991873 20:2102625-2102647 CCTCCCCCGTTCAATCAGCGGCG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1168991885 20:2102655-2102677 CCGTCTTAAAGGGGCCGCGGCGG 0: 1
1: 0
2: 0
3: 3
4: 31
1168991865_1168991885 22 Left 1168991865 20:2102610-2102632 CCCGCTTTCCCCTCCCCTCCCCC 0: 1
1: 9
2: 119
3: 1111
4: 6797
Right 1168991885 20:2102655-2102677 CCGTCTTAAAGGGGCCGCGGCGG 0: 1
1: 0
2: 0
3: 3
4: 31
1168991876_1168991885 3 Left 1168991876 20:2102629-2102651 CCCCGTTCAATCAGCGGCGGTGG 0: 1
1: 0
2: 0
3: 1
4: 28
Right 1168991885 20:2102655-2102677 CCGTCTTAAAGGGGCCGCGGCGG 0: 1
1: 0
2: 0
3: 3
4: 31
1168991878_1168991885 2 Left 1168991878 20:2102630-2102652 CCCGTTCAATCAGCGGCGGTGGC 0: 1
1: 0
2: 0
3: 1
4: 36
Right 1168991885 20:2102655-2102677 CCGTCTTAAAGGGGCCGCGGCGG 0: 1
1: 0
2: 0
3: 3
4: 31
1168991866_1168991885 21 Left 1168991866 20:2102611-2102633 CCGCTTTCCCCTCCCCTCCCCCG 0: 1
1: 1
2: 81
3: 694
4: 3867
Right 1168991885 20:2102655-2102677 CCGTCTTAAAGGGGCCGCGGCGG 0: 1
1: 0
2: 0
3: 3
4: 31
1168991869_1168991885 12 Left 1168991869 20:2102620-2102642 CCTCCCCTCCCCCGTTCAATCAG 0: 1
1: 0
2: 0
3: 25
4: 332
Right 1168991885 20:2102655-2102677 CCGTCTTAAAGGGGCCGCGGCGG 0: 1
1: 0
2: 0
3: 3
4: 31
1168991875_1168991885 4 Left 1168991875 20:2102628-2102650 CCCCCGTTCAATCAGCGGCGGTG 0: 1
1: 0
2: 0
3: 0
4: 13
Right 1168991885 20:2102655-2102677 CCGTCTTAAAGGGGCCGCGGCGG 0: 1
1: 0
2: 0
3: 3
4: 31
1168991872_1168991885 8 Left 1168991872 20:2102624-2102646 CCCTCCCCCGTTCAATCAGCGGC 0: 1
1: 0
2: 0
3: 3
4: 63
Right 1168991885 20:2102655-2102677 CCGTCTTAAAGGGGCCGCGGCGG 0: 1
1: 0
2: 0
3: 3
4: 31
1168991867_1168991885 14 Left 1168991867 20:2102618-2102640 CCCCTCCCCTCCCCCGTTCAATC 0: 1
1: 0
2: 3
3: 43
4: 670
Right 1168991885 20:2102655-2102677 CCGTCTTAAAGGGGCCGCGGCGG 0: 1
1: 0
2: 0
3: 3
4: 31
1168991870_1168991885 9 Left 1168991870 20:2102623-2102645 CCCCTCCCCCGTTCAATCAGCGG 0: 1
1: 0
2: 0
3: 6
4: 67
Right 1168991885 20:2102655-2102677 CCGTCTTAAAGGGGCCGCGGCGG 0: 1
1: 0
2: 0
3: 3
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168991885 Original CRISPR CCGTCTTAAAGGGGCCGCGG CGG Intronic
911638828 1:100266130-100266152 TCGGCTTAAAGGAGCCGCGCTGG - Intergenic
915141731 1:153772250-153772272 CTGTCTTAAGGGGGCCCTGGCGG + Intronic
922659201 1:227414546-227414568 CCTTCTTAAAGGAGCAGTGGTGG - Intergenic
922776267 1:228215526-228215548 GCGTCAGAAAGGGGCCGAGGAGG - Intronic
1069832732 10:71291078-71291100 CCGTCTTAAAGTTGACGGGGTGG - Exonic
1073359861 10:102889678-102889700 CCATCTGAAAGGGGCGGGGGGGG - Intronic
1106269262 13:28138394-28138416 TTTTCTTAAAGGGGCCGCGCGGG - Intergenic
1121342971 14:93115961-93115983 GCCTCTTAAAGGCGCCGCGCCGG + Intronic
1122826081 14:104371294-104371316 CCGCCTTAGAGGGGCCGTAGAGG + Intergenic
1129463856 15:75712958-75712980 CCTTCTTAAAGGGCCCGTGCGGG + Intergenic
1133033901 16:3024119-3024141 CCGGCTTAAGGGGGCTGCGGTGG + Exonic
1145243650 17:21253533-21253555 ACCTCTTAAAGGGGCCGCGCCGG + Intergenic
1146488588 17:33263581-33263603 CAGTCTTCATGGGGCCGCAGAGG - Intronic
1146903220 17:36601549-36601571 CCGTCAGGAAGGGGCCGGGGAGG + Intergenic
1152689638 17:81712201-81712223 GCGCCTTAAAGCGGCCGCGAGGG - Intergenic
1160105493 18:75970585-75970607 CCGTCTTAGTGGGGGCCCGGTGG - Intergenic
1161268518 19:3376180-3376202 GCATCTTAGAGGGGCCGAGGCGG + Intronic
1163507936 19:17719436-17719458 GCCTCTTAAAGGGGCCGCACCGG - Exonic
1163783581 19:19262876-19262898 GTGTATTAAAGGGGCCGCGGGGG + Intergenic
1166197917 19:41219055-41219077 CTTTCTTAAAGGGGCCAGGGAGG - Intergenic
934052027 2:88219200-88219222 GCCTCTTAGAGGGGCCGCAGGGG + Intergenic
948537267 2:238655376-238655398 CCCTCTTCAAGGGGCAGCAGGGG + Intergenic
948942479 2:241203326-241203348 GCGTCTTGAAGGGGCCCTGGGGG - Exonic
1168991885 20:2102655-2102677 CCGTCTTAAAGGGGCCGCGGCGG + Intronic
1176050027 20:63114186-63114208 CCGTCTTCAGGGAGCCGCGTGGG + Intergenic
1183607158 22:38872431-38872453 GGCTCTTAAAGGGGCCGCGCGGG + Intergenic
950024360 3:9810282-9810304 GCGTCTTGAAGGCGCCGCTGAGG - Exonic
954822927 3:53347317-53347339 GTCTCTTAAAGGGGCCGCGCGGG - Intronic
994197478 5:96936126-96936148 CCGGCTGTAAGGAGCCGCGGCGG + Exonic
998157597 5:139795574-139795596 CTTTCTTAAAGGGCCCGCGCGGG + Intergenic
1016996368 6:149964673-149964695 CCGGCGGAAAGGAGCCGCGGAGG - Intronic
1028894319 7:96023524-96023546 CCGTCTTTAAGTGGCTGTGGAGG - Intronic
1059309592 9:113378913-113378935 CCCTCTCAAAGGGGCCTGGGTGG - Intergenic
1061720147 9:132546379-132546401 CCTTCATAATGGGGCCGGGGTGG - Intronic
1062634639 9:137484491-137484513 CTGTCTTCGAGGGGACGCGGCGG - Intronic