ID: 1168993362

View in Genome Browser
Species Human (GRCh38)
Location 20:2113660-2113682
Sequence TTCAATAATCCCAGTGCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1733
Summary {0: 1, 1: 0, 2: 3, 3: 136, 4: 1593}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168993362_1168993365 0 Left 1168993362 20:2113660-2113682 CCTACAGCACTGGGATTATTGAA 0: 1
1: 0
2: 3
3: 136
4: 1593
Right 1168993365 20:2113683-2113705 ATCGGTGACTTCCAAGGATTTGG 0: 1
1: 0
2: 0
3: 20
4: 139
1168993362_1168993366 4 Left 1168993362 20:2113660-2113682 CCTACAGCACTGGGATTATTGAA 0: 1
1: 0
2: 3
3: 136
4: 1593
Right 1168993366 20:2113687-2113709 GTGACTTCCAAGGATTTGGTTGG 0: 1
1: 0
2: 0
3: 15
4: 150
1168993362_1168993371 15 Left 1168993362 20:2113660-2113682 CCTACAGCACTGGGATTATTGAA 0: 1
1: 0
2: 3
3: 136
4: 1593
Right 1168993371 20:2113698-2113720 GGATTTGGTTGGGGTTGAGTGGG 0: 1
1: 0
2: 3
3: 27
4: 231
1168993362_1168993370 14 Left 1168993362 20:2113660-2113682 CCTACAGCACTGGGATTATTGAA 0: 1
1: 0
2: 3
3: 136
4: 1593
Right 1168993370 20:2113697-2113719 AGGATTTGGTTGGGGTTGAGTGG 0: 1
1: 0
2: 7
3: 24
4: 337
1168993362_1168993368 6 Left 1168993362 20:2113660-2113682 CCTACAGCACTGGGATTATTGAA 0: 1
1: 0
2: 3
3: 136
4: 1593
Right 1168993368 20:2113689-2113711 GACTTCCAAGGATTTGGTTGGGG 0: 1
1: 0
2: 2
3: 10
4: 175
1168993362_1168993364 -6 Left 1168993362 20:2113660-2113682 CCTACAGCACTGGGATTATTGAA 0: 1
1: 0
2: 3
3: 136
4: 1593
Right 1168993364 20:2113677-2113699 ATTGAAATCGGTGACTTCCAAGG 0: 1
1: 0
2: 0
3: 11
4: 143
1168993362_1168993367 5 Left 1168993362 20:2113660-2113682 CCTACAGCACTGGGATTATTGAA 0: 1
1: 0
2: 3
3: 136
4: 1593
Right 1168993367 20:2113688-2113710 TGACTTCCAAGGATTTGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168993362 Original CRISPR TTCAATAATCCCAGTGCTGT AGG (reversed) Intronic
900197694 1:1385416-1385438 GCCTGTAATCCCAGTGCTGTTGG - Intergenic
900199473 1:1397600-1397622 ATCTGTAATCCCAGTGCTTTGGG + Intronic
900322366 1:2091294-2091316 TTCTATAATCCCAGCACTTTGGG - Intronic
900614574 1:3559395-3559417 ACCTATAATCCCAGTGCTTTGGG + Intronic
900629582 1:3626836-3626858 ATCTATAATCCCAGCGCTTTGGG - Intronic
901192577 1:7421411-7421433 ACCTATAATCCCAGTGCTTTAGG - Intronic
901246164 1:7732932-7732954 GCCTATAATCCCAGCGCTGTAGG + Intronic
901248800 1:7756587-7756609 GCCTATAATCCCAGTGCTTTGGG + Intronic
901273218 1:7969930-7969952 GTCTATAATCCCAGTGGTTTGGG + Intronic
901330070 1:8400509-8400531 TCCTATAATCTCAGTGCTTTGGG - Intronic
901345990 1:8542763-8542785 ACCTATAATCCCAGTGCTTTGGG - Intronic
901359545 1:8685115-8685137 TCCTATAATCCCAGTGCTTTGGG - Intronic
901420657 1:9148974-9148996 TCCTGTAATCCCAGTGCTTTGGG + Intergenic
901577675 1:10213875-10213897 ATCTGTAATCCCAGTGCTTTGGG + Intronic
901606728 1:10464990-10465012 ATCAATAATCCCAGCACTTTGGG + Intronic
901927287 1:12574424-12574446 ACCAGTAATCCCAGTGCTTTGGG - Intronic
902102889 1:14007912-14007934 CACAATGATCCCTGTGCTGTTGG + Intergenic
902283534 1:15391450-15391472 TCCTGTAATCCCAGTGCTTTGGG - Intronic
902318866 1:15645607-15645629 ACCTATAATCCCAGTGCTTTAGG + Intronic
902348990 1:15839565-15839587 TTCTATAATCCCAGCACTTTGGG + Intergenic
902806905 1:18866720-18866742 TGCCGTAATCCCAGTGCTTTGGG - Intronic
902910189 1:19590358-19590380 TTCTATAATCCCAGCACTTTGGG + Intergenic
903048809 1:20585746-20585768 GTCTGTAATCCCAGTGCTTTGGG - Intergenic
903049889 1:20592831-20592853 GCCAGTAATCCCAGTGCTTTGGG + Intronic
903861227 1:26365781-26365803 GCCTATAATCCCAGTGCTTTGGG + Intronic
903865441 1:26394257-26394279 ACCTATAATCCCAGTGCTTTGGG + Intergenic
904110851 1:28124787-28124809 TGCTGTAATCCCAGTGCTTTGGG - Intergenic
904129965 1:28268286-28268308 ATCTGTAATCCCAGTGCTTTGGG + Intronic
904152988 1:28458405-28458427 TTCTGTAATCCCAGCACTGTGGG - Intronic
904471082 1:30736693-30736715 ATCTGTAATCCCAGTGCTTTGGG - Intronic
904658707 1:32068805-32068827 GCCCATAATCCCAGTGCTTTGGG - Intergenic
904761231 1:32805700-32805722 GTCTATAATCCCAGCACTGTGGG + Intronic
905044879 1:34989276-34989298 ACCTATAATCCCAGTGCTTTGGG + Intronic
905069332 1:35211488-35211510 GTCTGTAATCCCAGTGCTTTGGG + Intergenic
905138850 1:35824537-35824559 GCCAAAAATCCCAGTGCTGTGGG + Intronic
905246646 1:36619534-36619556 GTCTGTAATCCCAGTGCTTTGGG + Intergenic
905354801 1:37373980-37374002 ATCTGTAATCCCAGTGCTTTGGG + Intergenic
905411773 1:37775316-37775338 CCCTATAATCCCAGTGCTCTGGG - Intergenic
905420194 1:37837314-37837336 GTCTGTAATCCCAGTGCTTTGGG - Intronic
905453108 1:38069609-38069631 GCCTATAATCCCAGTGCTTTGGG - Intergenic
905557313 1:38897445-38897467 TCCTATAATCTCAGTGCTTTGGG + Intronic
905607406 1:39314646-39314668 TAGAATAATCCCTGTGCTATGGG - Intronic
905700552 1:40010036-40010058 ATCTGTAATCCCAGTGCTTTGGG - Intergenic
905757118 1:40520160-40520182 TCCTGTAATCCCAGTGCTTTGGG + Intergenic
905808249 1:40892599-40892621 ACCTATAATCCCAGTGCTTTGGG - Intergenic
905833850 1:41099111-41099133 TTAGATAATCCCAGTTTTGTTGG - Intronic
905859924 1:41343404-41343426 GCCTATAATCCCAGTGCTTTGGG + Intergenic
905986988 1:42294497-42294519 GTCCATAATCCCAGTACTTTGGG + Intronic
906085041 1:43125555-43125577 ATCTGTAATCCCAGTGCTTTAGG - Intergenic
906350352 1:45053500-45053522 TCCTGTAATCCCAGTGCTTTGGG + Intronic
906623616 1:47306511-47306533 GCCTATAATCCCAGTGCTTTGGG - Intronic
906700287 1:47852683-47852705 TTCAATAATCCCAGAGGAGGAGG + Intronic
906905700 1:49889495-49889517 TTCTATAATCCCAGCTCTTTGGG + Intronic
906919840 1:50051992-50052014 TTTAAGAATACCAGTCCTGTTGG + Intronic
907019807 1:51055770-51055792 ATCTATAATCCCACTGCTTTGGG - Intergenic
907033905 1:51199442-51199464 TCCTGTAATCCCAGTGCTTTGGG + Intergenic
907067960 1:51504859-51504881 ACCTATAATCCCAGTGCTTTGGG + Intronic
907072126 1:51545517-51545539 ACCTATAATCCCAGTGCTTTGGG + Intergenic
907133391 1:52117249-52117271 ATAAATAATCCCAGTGCTTTGGG + Intergenic
907176588 1:52528970-52528992 TCCTGTAATCCCAGTGCTTTGGG - Intronic
907181690 1:52576196-52576218 TCCTATAATCCCAGTGCTTTGGG + Intergenic
907683816 1:56590474-56590496 GCCTATAATCCCAGTGCTTTGGG - Intronic
907729929 1:57056237-57056259 GCCTATAATCCCAGTGCTTTGGG + Intronic
908261131 1:62339946-62339968 ATCTATAATCCCAGCACTGTAGG + Intergenic
908358048 1:63341464-63341486 GTCTGTAATCCCAGTGCTTTGGG - Intergenic
908360708 1:63366681-63366703 CTCCATATTCCCAGTGCTGATGG + Intergenic
908680609 1:66656906-66656928 GCCTATAATCCCAGTGCTTTGGG + Intronic
909069777 1:70980502-70980524 GTCTGTAATCCCAGTGCTTTGGG + Intronic
909785889 1:79612628-79612650 TTCCATAATCCTAGTGCTTCGGG + Intergenic
910128473 1:83873256-83873278 TTCCCTAATGCAAGTGCTGTGGG + Intronic
910328761 1:86043783-86043805 GCCTATAATCCCAGTGCTTTGGG - Intronic
910335625 1:86126717-86126739 ACCTGTAATCCCAGTGCTGTGGG - Intronic
910607466 1:89102667-89102689 GCCTATAATCCCAGTGCTTTGGG + Intergenic
910875350 1:91873228-91873250 CCCTATAATCCCAGTGCTTTAGG - Intronic
910902074 1:92131967-92131989 ATCTATAATCCCAGTACTTTGGG - Intronic
910905059 1:92166682-92166704 TCCTATAATCCCAGTACTTTGGG - Intergenic
910967995 1:92826980-92827002 TGCCTTAATCCCAGTGCTTTGGG + Intergenic
911207898 1:95111030-95111052 TCCTGTAATCCCAGTGCTTTGGG + Intergenic
911611267 1:99961244-99961266 ACAAGTAATCCCAGTGCTGTGGG + Intergenic
911654813 1:100431580-100431602 TCCTGTAATCCCAGTGCTTTAGG + Intronic
912329184 1:108801926-108801948 ATCTATAATCCCAGTGCTTTGGG - Intronic
912338105 1:108882208-108882230 ATCTGTAATCCCAGTGCTTTGGG - Intronic
912367409 1:109146050-109146072 ATCTATAATCCCAGCACTGTGGG + Intronic
912532375 1:110335529-110335551 ATCTGTAATCCCAGTGCTTTGGG + Intergenic
912572792 1:110636886-110636908 GTCTGTAATCCCAGTGCTTTGGG + Intergenic
912731411 1:112109569-112109591 TTCAAAAATCCCAGGGCCCTAGG - Intergenic
912827419 1:112918539-112918561 GTCTATAATCCCAGTGCTTTGGG + Intronic
912856542 1:113173281-113173303 TTTAATAATCCCAGCACTTTGGG - Intergenic
913235822 1:116782211-116782233 TTCTATAATCCCAGTACTTTTGG - Intergenic
913238306 1:116804358-116804380 GTCTATAATCCCAGTTCTTTGGG + Intergenic
914203206 1:145504927-145504949 GTCTGTAATCCCAGTGCTTTGGG - Intergenic
914237135 1:145822850-145822872 GTCTGTAATCCCAGTGCTTTGGG - Intronic
914338541 1:146738903-146738925 TCCTATAATCCCAGTACTTTGGG + Intergenic
914398228 1:147290910-147290932 GACTATAATCCCAGTGCTTTGGG - Intronic
914482328 1:148078081-148078103 GTCTGTAATCCCAGTGCTTTGGG - Intergenic
914837526 1:151219948-151219970 ATCTATAATCCCAGTACTTTGGG - Intronic
914860628 1:151382989-151383011 TCCTGTAATCCCAGTGCTTTGGG + Intergenic
915532855 1:156513490-156513512 ATCTGTAATCCCAGTGCTTTGGG + Intergenic
915612558 1:157006229-157006251 GTCTATAATCCTAGTGCTTTGGG - Intronic
915697264 1:157756421-157756443 GCCTATAATCCCAGTGCTTTGGG + Intronic
915963633 1:160287296-160287318 ATCTATAATCCCAGTACTTTGGG - Intergenic
916096256 1:161353721-161353743 AACTATAATCCCAGTGCTTTGGG + Intronic
916277907 1:163014475-163014497 GGAAATAATCCCAGTGTTGTTGG - Intergenic
916583714 1:166131249-166131271 TCCTGTAATCCCAGTGCTTTGGG - Intronic
916936623 1:169634500-169634522 TGCCATAATCCCAGCGCTTTGGG + Intergenic
916956341 1:169840015-169840037 TTCAATGATCACATGGCTGTAGG + Intronic
917099894 1:171434566-171434588 GCCTATAATCCCAGTGCTTTTGG - Intergenic
917139090 1:171816730-171816752 TTATATAATCCCAGGGCTGAAGG + Intergenic
917145881 1:171890925-171890947 ATCTGTAATCCCAGTGCTTTGGG - Intronic
917170964 1:172173586-172173608 GCCTATAATCCCAGTGCTTTGGG - Intronic
917347760 1:174046159-174046181 ACCAATAATCCCAGTACTTTGGG - Intergenic
917386234 1:174478533-174478555 TTAAATAATCCCAGCACTCTGGG - Intronic
917410423 1:174754759-174754781 ACCTATAATCCCAGTGCTTTGGG - Intronic
917470068 1:175318922-175318944 TTCAATAATCCCAAAGAAGTTGG - Exonic
917753570 1:178076885-178076907 ATCTGTAATCCCAGTGCTTTGGG - Intergenic
917905524 1:179584201-179584223 TCCTATAATCCCAGTGTTTTGGG + Intergenic
917952957 1:180060387-180060409 GCCTATAATCCCAGTGCTTTGGG + Intronic
918171265 1:181999503-181999525 ACCTATAATCCCAGTGCTTTTGG - Intergenic
918199255 1:182251932-182251954 ATCTGTAATCCCAGTGCTTTGGG + Intergenic
918237343 1:182593257-182593279 ATCTATAATCTCAGTGCTTTGGG - Intergenic
918318300 1:183341416-183341438 GTCTGTAATCCCAGTGCTATGGG + Intronic
918622519 1:186621733-186621755 GCCTATAATCCCAGTGCTTTGGG - Intergenic
919224048 1:194671130-194671152 GTCTATAATCTCAGTGCTTTGGG + Intergenic
919648235 1:200118274-200118296 TCCTGTAATCCCAGTGCTTTGGG - Intronic
919788085 1:201272885-201272907 TTCACTTTTCCCAGGGCTGTTGG + Intergenic
919843679 1:201627535-201627557 TTCTATAATCCCAGTACTTAGGG - Intronic
919935897 1:202250661-202250683 TTCTGTAATCCCAGCACTGTAGG - Intronic
920075361 1:203332478-203332500 TGCTATAATCCCAGCACTGTGGG - Intergenic
920111625 1:203591297-203591319 ATCCATAATCCTAGTGCTTTGGG + Intergenic
920167787 1:204047882-204047904 ATCTGTAATCCCAGTGCTTTGGG - Intergenic
920411592 1:205765807-205765829 TCCTATAATCCCAGCACTGTGGG + Intergenic
920421419 1:205836760-205836782 ACCTATAATCCCAGTGCTTTGGG - Intronic
920537176 1:206745394-206745416 TTCTGTAATCTCAGTGCTTTAGG + Intergenic
920583323 1:207134105-207134127 GCCTATAATCCCAGTGCTTTGGG - Intronic
920923212 1:210315661-210315683 ATCTGTAATCCCAGTACTGTGGG + Intergenic
921838402 1:219802129-219802151 GCCAGTAATCCCAGTGCTTTGGG + Intronic
921853591 1:219956552-219956574 ACCTATAATCCCAGTGCTTTGGG + Intronic
921897630 1:220416830-220416852 TCCTATAATCCCAGTGCTTTGGG - Intergenic
922174612 1:223187551-223187573 GTCTGTAATCCCAGTGCTTTGGG - Intergenic
922324876 1:224518587-224518609 ACCAGTAATCCCAGTGCTTTGGG - Intronic
922338380 1:224635971-224635993 CGCAGTAATCCCAGTGCTTTGGG - Intronic
922439470 1:225641373-225641395 TTCAGTAATCCCAGCACTTTGGG + Intronic
922658930 1:227412131-227412153 TTCTGTAATCCCAGCACTGTGGG + Intergenic
922688578 1:227667945-227667967 TTCAATAAACTCAGGGCAGTGGG - Intronic
922725766 1:227922342-227922364 TCCCATAATCCCAGTCCTGCCGG + Intronic
922860161 1:228809775-228809797 TTGAATAATTTCAGGGCTGTGGG - Intergenic
923578558 1:235185074-235185096 GCCTATAATCCCAGTGCTTTGGG - Intronic
923589565 1:235307182-235307204 GTCTGTAATCCCAGTGCTTTGGG + Intronic
923623848 1:235598348-235598370 GTCTGTAATCCCAGTGCTTTGGG + Intronic
923741053 1:236655412-236655434 TTCAATTATCCCTGTACTGTAGG + Intergenic
923741122 1:236656076-236656098 GCCTATAATCCCAGTGCTTTGGG + Intergenic
923830154 1:237546638-237546660 TTCTATAATCCCAGCACTTTGGG - Intronic
923848076 1:237760083-237760105 TACTATAATCCCAGAGCTTTGGG + Intronic
923940069 1:238812454-238812476 TCCTGTAATCCCAGTGCTTTGGG + Intergenic
924149231 1:241110942-241110964 TCCCATAATCCCAGAGCTTTGGG - Intronic
924199512 1:241644322-241644344 TCCTGTAATCCCAGTGCTTTGGG + Intronic
924479795 1:244418578-244418600 GTCTGTAATCCCAGTGCTTTGGG - Intronic
924571627 1:245242129-245242151 TAACATAATCCCAGTGCTTTGGG + Intronic
1062825827 10:567887-567909 ACCTATAATCCCAGTGCTTTGGG - Intronic
1063082080 10:2776954-2776976 TTCTATAATCCCAGCACTTTGGG + Intergenic
1063454975 10:6176643-6176665 GTCTGTAATCCCAGTGCTTTGGG - Intronic
1063612339 10:7573405-7573427 GTCCATAATCCCAGTGCTTCCGG + Intronic
1063714342 10:8512997-8513019 GCCTATAATCCCAGTGCTTTGGG - Intergenic
1063732207 10:8710587-8710609 GCCTATAATCCCAGTGCTTTGGG - Intergenic
1064067012 10:12190866-12190888 CCCTGTAATCCCAGTGCTGTGGG - Intronic
1064343773 10:14511550-14511572 TTCTATAATCCTAGTGTTGGAGG - Intergenic
1064390315 10:14936405-14936427 GTCTGTAATCCCAGTGCTTTGGG - Intronic
1064411290 10:15106839-15106861 GTCTATAATCCCAGTACTTTGGG + Intronic
1064692381 10:17931215-17931237 ATCTGTAATCCCAGTGCTTTGGG - Intergenic
1064727587 10:18297283-18297305 TTCTATAATCCCAGCACTTTGGG + Intronic
1064735869 10:18381247-18381269 GCCTATAATCCCAGTGCTTTGGG + Intronic
1064781175 10:18840421-18840443 TGTAATAATCCCAGCGCTTTGGG - Intergenic
1064787901 10:18918464-18918486 GTCTGTAATCCCAGTGCTTTGGG - Intergenic
1064852384 10:19723472-19723494 ACCCATAATCCCAGTGCTTTAGG + Intronic
1064876110 10:19996179-19996201 TTCTATAATCCCAGCACTTTGGG + Intronic
1064946084 10:20791652-20791674 GCCCATAATCCCAGTGCTTTGGG - Intronic
1065043984 10:21728766-21728788 GTCTATAATCCCAGCGCTTTGGG + Intronic
1065050465 10:21786728-21786750 GCCTATAATCCCAGTGCTTTGGG - Intronic
1065207101 10:23367158-23367180 GTCAGTAATCCCAGTACTTTGGG - Intergenic
1065318992 10:24491547-24491569 ATCTGTAATCCCAGTGCTTTGGG - Intronic
1065323501 10:24530635-24530657 GCCTATAATCCCAGTGCTTTTGG + Intronic
1065353685 10:24818362-24818384 GCCTATAATCCCAGTGCTTTTGG - Intergenic
1065357350 10:24855532-24855554 ATCTGTAATCCCAGTGCTTTGGG + Intronic
1065440422 10:25748126-25748148 TCCTGTAATCCCAGTGCTTTGGG - Intergenic
1065445228 10:25791558-25791580 TCCTGTAATCCCAGTGCTTTGGG + Intergenic
1065504407 10:26414917-26414939 GTCTATAATCTCAGTGCTCTGGG + Intergenic
1065507951 10:26448300-26448322 GCCTATAATCCCAGTGCTTTGGG - Intronic
1065620606 10:27577162-27577184 TTCTATAATCCCAGCACTCTGGG + Intergenic
1065745646 10:28839037-28839059 GCCTATAATCCCAGTGCTTTGGG - Intergenic
1066022069 10:31313675-31313697 GCCTATAATCCCAGTGCTTTGGG - Intergenic
1066212715 10:33255709-33255731 CTCTGTAATCCCAGTGCTTTGGG - Intronic
1066227667 10:33399959-33399981 ATCTATAATCCCAGTACTTTGGG - Intergenic
1066271239 10:33826018-33826040 TCCAATACTCCCAGTGGGGTAGG - Intergenic
1066314512 10:34230766-34230788 GCCCATAATCCCAGTGCTTTGGG + Intronic
1066327728 10:34381670-34381692 TTCCATAATCCCAGCACTTTGGG + Intronic
1066495540 10:35938525-35938547 GCCTATAATCCCAGTGCTTTGGG + Intergenic
1066750157 10:38646755-38646777 GTCTATAATGCCAGTGCTTTGGG - Intergenic
1067027260 10:42854822-42854844 TCCTATAATCCCAGTACTTTGGG - Intergenic
1067097736 10:43313623-43313645 GCCTATAATCCCAGTGCTTTGGG + Intergenic
1068049490 10:51931352-51931374 TTCCATAATTCCAGTGCTTTGGG + Intronic
1068159102 10:53240866-53240888 GCCTATAATCCTAGTGCTGTGGG + Intergenic
1068639707 10:59389375-59389397 TACTATAATGCCAGTGCTTTGGG - Intergenic
1068901496 10:62274455-62274477 TCCTGTAATCCCAGTGCTTTGGG + Intergenic
1069114474 10:64488342-64488364 GCCTATAATCCCAGTGCTTTGGG + Intergenic
1069387139 10:67894013-67894035 GCCTATAATCCCAGTGCTTTGGG + Intronic
1069462993 10:68612432-68612454 TTCTATAATCCCAGCAGTGTGGG + Intronic
1069556563 10:69402249-69402271 TTCTATAATCCCAGCACTTTAGG - Intergenic
1069681597 10:70289410-70289432 ACCTATAATCCCAGTGCTTTGGG - Intergenic
1070021145 10:72587211-72587233 GTCTATAATCCCAGTGCCTTGGG + Intronic
1070050138 10:72880866-72880888 GCCTATAATCCCAGTGCTTTGGG + Intronic
1070071208 10:73091424-73091446 ATCTGTAATCCCAGTGCTTTGGG - Intronic
1070173714 10:73952658-73952680 TCCTATAATCCCAGTACTTTGGG - Intergenic
1070223713 10:74478166-74478188 GCCTATAATCCCAGTGCTTTGGG - Intronic
1070237833 10:74648920-74648942 ACCTATAATCCCAGTGCTTTGGG + Intronic
1070249986 10:74765273-74765295 GCCTATAATCCCAGTGCTTTGGG + Intergenic
1070261221 10:74857758-74857780 ATCTATAATCCCAATGCTTTGGG + Intronic
1070566005 10:77604443-77604465 TTCTATAATCCCAGTACTTTGGG + Intronic
1070601652 10:77870421-77870443 ACCTATAATCCCAGTGCTTTGGG + Intronic
1071021834 10:81066409-81066431 GTCTGTAATCCCAGTGCTTTGGG + Intergenic
1071081601 10:81819226-81819248 TACCTTAATCCCAGTGCTTTGGG + Intergenic
1071115557 10:82214727-82214749 AACAGTAATCCCAGTGCTTTGGG - Intronic
1071427771 10:85576402-85576424 GCCTATAATCCCAGTGCTTTGGG + Intergenic
1071604593 10:86976349-86976371 ACCCGTAATCCCAGTGCTGTGGG - Intronic
1071766036 10:88666595-88666617 GTCTATAATCCCAGTGCTTTGGG + Intronic
1071768093 10:88691744-88691766 CTCAATAATCCCAGCACTTTAGG + Intergenic
1071803809 10:89094527-89094549 ACCTATAATCCCAGTGCTTTTGG + Intergenic
1072038344 10:91584747-91584769 TTCTATAATCCCAGAACTCTGGG - Intergenic
1072155365 10:92718731-92718753 TCCTGTAATCCCAGTGCTTTGGG + Intergenic
1072244636 10:93532155-93532177 TTCTGTAATCCCAGTACTTTGGG + Intergenic
1072368974 10:94744717-94744739 TCCTCTAATCCCAGTGCTTTGGG + Intronic
1072432619 10:95386850-95386872 ATCTATAACCCCAGTGCTTTGGG + Intronic
1072454848 10:95566899-95566921 TCCTATAATCTCAGTGCTTTGGG + Intergenic
1072604515 10:96968673-96968695 TTCTGTAATCCCAGTGTTTTGGG + Intronic
1072635058 10:97172654-97172676 TCCTATAATCCCAGTGCTTTGGG + Intronic
1072743612 10:97925005-97925027 GCCAGTAATCCCAGTACTGTGGG + Intronic
1072922348 10:99586699-99586721 GCCTATAATCCCAGTGCTTTGGG - Intergenic
1073211261 10:101804854-101804876 GCCTGTAATCCCAGTGCTGTGGG - Intronic
1073358330 10:102875215-102875237 ACCTGTAATCCCAGTGCTGTGGG + Intronic
1073409215 10:103325757-103325779 TCCTATAATCCTAGTGCTTTGGG + Intronic
1073735291 10:106338018-106338040 TCCAATAATCCCAGCACTTTGGG + Intergenic
1073791820 10:106948411-106948433 GTCTGTAATCCCAGTGCTTTAGG + Intronic
1073816392 10:107212635-107212657 GCCTATAATCCCAGTGCTTTGGG + Intergenic
1074080455 10:110164448-110164470 TTCTGTAATCCCAGTACTTTAGG + Intergenic
1074311234 10:112325012-112325034 GTCTATAATCCCAGTACTTTGGG + Intergenic
1074339453 10:112612681-112612703 GCCTATAATCCCAGTGCTTTGGG - Intronic
1074376178 10:112942614-112942636 ATCTGTAATCCCAGTGCTTTGGG + Intergenic
1074409322 10:113211522-113211544 GCCTGTAATCCCAGTGCTGTGGG - Intergenic
1074493957 10:113962676-113962698 ACCTATAATCCCAGTGCTTTGGG + Intergenic
1074638982 10:115356928-115356950 TTCAATAGTTTCAGTTCTGTAGG + Intronic
1074799856 10:116988797-116988819 GCCTATAATCCCAGTGCTTTGGG - Intronic
1075029581 10:119013199-119013221 TCCTATAATCCCAGTACTTTGGG + Intergenic
1075155163 10:119969791-119969813 TTTATTAAGCCCAGTGCAGTTGG + Intergenic
1075378149 10:121996313-121996335 TTCTGTAATCCCAGCACTGTGGG - Intronic
1075391297 10:122094536-122094558 TATAATAATCCCAGTGCTTTAGG - Intronic
1075735560 10:124662554-124662576 ATCTGTAATCCCAGTGCTTTCGG + Intronic
1076521121 10:131081990-131082012 TTCCACACTCCCAGTCCTGTCGG - Intergenic
1077631425 11:3813641-3813663 GCCTATAATCCCAGTGCTTTGGG - Intronic
1077708410 11:4511320-4511342 CCCAAGACTCCCAGTGCTGTGGG + Intergenic
1078167220 11:8898031-8898053 GCCTATAATCCCAGTGCTTTAGG - Intronic
1078172622 11:8940220-8940242 GCCTGTAATCCCAGTGCTGTGGG - Intergenic
1078229319 11:9425344-9425366 TTCTATAATCCCAGCACTTTCGG + Intronic
1078381955 11:10850685-10850707 ATCGGTAATCCCAGTGCTTTGGG + Intronic
1078806651 11:14712342-14712364 TCCTATAATCTCAGTGCTTTGGG - Intronic
1078809599 11:14745082-14745104 GCCTATAATCCCAGTGCTTTGGG - Intronic
1078991725 11:16654547-16654569 GTCTATAATCCCAGTGATTTGGG - Intronic
1079052989 11:17179419-17179441 GCCAGTAATCCCAGTGCTTTGGG - Intronic
1079189474 11:18265761-18265783 TCCTATAATCCCAATGCTTTTGG - Intergenic
1079232003 11:18656904-18656926 TGCCATAATCCCAGTACTTTGGG - Intergenic
1079268839 11:18962605-18962627 TTCTATAATCCCAGCACTTTGGG + Intergenic
1079450909 11:20599105-20599127 TTCAGTCATCGCAGAGCTGTGGG + Intergenic
1079692554 11:23437979-23438001 GTCTATAATCCCAGTGCTTTTGG - Intergenic
1080080637 11:28214291-28214313 GCCTATAATCCCAGTCCTGTGGG - Intronic
1080187061 11:29502739-29502761 GTCTGTAATCCCAGTGCTTTGGG + Intergenic
1080597290 11:33784685-33784707 TTGCATAATCTCAGTGATGTGGG - Intergenic
1080805509 11:35649557-35649579 ACCTATAATCCCAGTGCTTTGGG + Intergenic
1080916332 11:36664102-36664124 ACCTATAATCCCAGTGCTCTGGG - Intergenic
1081015678 11:37876541-37876563 GCCAGTAATCCCAGTGCTTTGGG - Intergenic
1081204649 11:40261125-40261147 GCCTATAATCCCAGTGCTGTGGG - Intronic
1081741495 11:45444227-45444249 ACCTATAATCCCAGTGCTTTGGG + Intergenic
1081894262 11:46571414-46571436 TTCTGTAATCCCAGTGGTTTGGG + Intronic
1081952281 11:47054560-47054582 ATCTGTAATCCCAGTGCTTTGGG - Intronic
1082003182 11:47405372-47405394 GCCTATAATCCCAGTGCTTTGGG + Intergenic
1082058400 11:47839348-47839370 GTCTATAATCCCAGCACTGTGGG - Intronic
1082220602 11:49631201-49631223 ATCAGTAATCCCAGTACTTTTGG + Intergenic
1082278841 11:50247838-50247860 GTCAATAATCCCAGCACTTTGGG + Intergenic
1082825875 11:57578473-57578495 ATCTATATTCCCAGTGCTTTGGG + Intergenic
1082892065 11:58150333-58150355 TCCTATAATCCCAGTGTTGGGGG + Intronic
1083085697 11:60142369-60142391 TCCAATAATCCCAGCACTCTGGG - Intergenic
1083279218 11:61615575-61615597 ACCTATAATCCCAGTGCTTTGGG - Intergenic
1083316945 11:61821258-61821280 GCCTATAATCCCAGTGCTTTGGG + Intronic
1083404912 11:62449983-62450005 ATCTGTAATCCCAGTGCTTTGGG + Intronic
1083437783 11:62654549-62654571 TCCTGTAATCCCAGTGCTTTGGG - Intronic
1083453810 11:62764533-62764555 ACCTATAATCCCAGTGCTTTGGG + Intronic
1083567433 11:63731337-63731359 ATCTATAATCCCAGTACTTTGGG - Intronic
1083686195 11:64376838-64376860 TCCTATAATCCCAGCACTGTGGG + Intergenic
1083979430 11:66154175-66154197 GTCAGTAATCCCAGTGCTTTGGG + Intronic
1084299083 11:68234053-68234075 GCCTATAATCCCAGTGCTCTGGG - Intergenic
1084375732 11:68776137-68776159 TTCAGTAATCCCAGCACTTTGGG + Intronic
1084605936 11:70171705-70171727 TCCTGTAATCCCAGTGCTTTGGG + Intronic
1084677176 11:70642325-70642347 ATCCAGAATCGCAGTGCTGTGGG + Intronic
1084711469 11:70846513-70846535 GTCTATAATCCCAGTGCCTTGGG - Intronic
1084880509 11:72168073-72168095 GCCTATAATCCCAGTGCTTTGGG - Intergenic
1085143818 11:74173799-74173821 TCCTATAATCCCAGTACTTTGGG - Intronic
1085676328 11:78522215-78522237 GCCTATAATCCCAGTGCTTTGGG - Intronic
1086095948 11:83049996-83050018 GCCTATAATCCCAGTGCTTTGGG + Intronic
1086125039 11:83341605-83341627 TTCAATACAACCATTGCTGTAGG + Intergenic
1086629067 11:88993975-88993997 ATCAGTAATCCCAGTACTTTCGG - Intronic
1086849846 11:91796655-91796677 GCCTATAATCCCAGTGCTTTGGG - Intergenic
1086962867 11:92997750-92997772 TCCTATAATACCAGTGCTTTGGG - Intergenic
1087019637 11:93589302-93589324 TTTAATAATCCCAGCACTTTAGG - Intergenic
1087304952 11:96478202-96478224 GTCTATAATCCCAGCACTGTAGG + Intronic
1088247322 11:107831482-107831504 GTCTATAATCCCAGTGCTTTGGG - Intronic
1088284861 11:108177417-108177439 ATCTATAATCCCAGTGCTCTGGG - Intronic
1088319989 11:108545642-108545664 GTCTGTAATCCCAGTGCTTTGGG + Intronic
1088457869 11:110051234-110051256 TCCTATAATCCCAGTACTTTGGG + Intergenic
1088669543 11:112128077-112128099 GCCTATAATCCCAGTGCTTTGGG + Intronic
1088723467 11:112614196-112614218 ACCTATAATCCCAGTGCTTTGGG - Intergenic
1090960804 11:131555035-131555057 GCCAGTAATCCCAGTGCTTTGGG + Intronic
1091414239 12:266991-267013 GCCTATAATCCCAGTGCTTTGGG - Intergenic
1091491848 12:939407-939429 GTCTGTAATCCCAGTGCTTTGGG - Intronic
1091740235 12:2956012-2956034 ATCAGTAATCCCAGTACTTTGGG - Intergenic
1092063988 12:5574310-5574332 TTCAGTGACCCCAGTGCTGATGG + Intronic
1092348978 12:7740235-7740257 ATCTGTAATCCCAGTGCTTTGGG - Intronic
1092369525 12:7904948-7904970 TTCTATAATCCCAGCACTTTGGG - Intergenic
1092394058 12:8109589-8109611 TTCTGTAATGCCAGTGCTTTAGG + Intergenic
1092410473 12:8249093-8249115 TGCAATAATCACAGTGTTCTGGG + Intergenic
1092479380 12:8846443-8846465 TCCTGTAATCCCAGTGCTTTGGG + Intronic
1092715776 12:11389207-11389229 CTCTGTAATCCCAGTGCTGTGGG + Intronic
1092819403 12:12339235-12339257 ATAAATAATCCCAGTTTTGTAGG - Intronic
1092856494 12:12679054-12679076 GTCTATAATCCCAGTACTTTGGG - Intronic
1092864383 12:12747234-12747256 CACAGTAATCCCAGTGCTTTAGG - Intronic
1092890986 12:12969077-12969099 AGCAATAATTCCAGTGCTGCTGG + Intergenic
1092941302 12:13409797-13409819 ATCTGTAATCCCAGTGCTTTGGG + Intergenic
1093023477 12:14223841-14223863 TTCTATAATCCCAGCACTTTGGG + Intergenic
1093026250 12:14248139-14248161 ATCTGTAATCCCAGTGCTTTGGG + Intergenic
1093035001 12:14324532-14324554 TTCTATAATCCCAGTACTTTGGG - Intergenic
1093054714 12:14544431-14544453 TCCTATAATCCCAGTACTTTGGG - Intronic
1093099304 12:15008145-15008167 TTTAAAAAACCCAGTGATGTGGG - Intergenic
1093159030 12:15723062-15723084 GTCTATAATCCCAGAACTGTGGG + Intronic
1094008927 12:25785728-25785750 CTCTGTAATCCCAGTGCTTTTGG + Intergenic
1094137267 12:27141319-27141341 GCCTATAATCCCAGTGCTTTGGG - Intergenic
1094562608 12:31569547-31569569 GCCTATAATCCCAGTGCTTTGGG + Intronic
1094626534 12:32129627-32129649 GTCTATAATCCCAGGACTGTGGG - Intronic
1095043398 12:37470134-37470156 TTGAAAAATTCCATTGCTGTTGG - Intergenic
1095440485 12:42234726-42234748 TCCTATAATCCCAGTTCTTTGGG + Intronic
1095494760 12:42772729-42772751 TCCTGTAATCCCAGTGCTTTGGG + Intergenic
1095594781 12:43947072-43947094 GCCTATAATCCCAGTGCTTTGGG + Intronic
1095701892 12:45199127-45199149 GCCTATAATCCCAGTGCTTTGGG + Intergenic
1095770373 12:45948190-45948212 TCCTATAATCCCAGTGCTTTGGG - Intronic
1095920823 12:47528075-47528097 TCCTGTAATCCCAGTGCTTTGGG - Intergenic
1095994378 12:48067712-48067734 TCCTGTAATCCCAGTGCTTTAGG + Intronic
1096110742 12:49027711-49027733 ATCTGTAATCCCAGTGCTTTGGG - Intronic
1096119869 12:49081468-49081490 ACCTATAATCCCAGTGCTTTGGG + Intergenic
1096141187 12:49243888-49243910 GCCTATAATCCCAGTGCTTTGGG + Intronic
1096250240 12:50026936-50026958 GTCTGTAATCCCAGTGCTTTGGG - Intronic
1096285263 12:50294261-50294283 GCCTATAATCCCAGTGCTCTGGG - Intergenic
1096549970 12:52365711-52365733 TTCAATTATCACAGCCCTGTGGG + Intronic
1096689675 12:53312314-53312336 TTCTATAATCCCAGCACTTTGGG + Intronic
1096951264 12:55475462-55475484 ACCTATAATCCCAGTGCTTTGGG - Intergenic
1096954983 12:55516803-55516825 TTCAAGAACCCCAGTGTTATTGG + Intergenic
1097014702 12:55977232-55977254 TCCTGTAATCCCAGTGCTTTGGG - Intronic
1097164204 12:57074248-57074270 ATCTGTAATCCCAGTGCTTTGGG - Intronic
1097255602 12:57671896-57671918 GCCTATAATCCCAGTGCTTTGGG + Intergenic
1097353449 12:58574692-58574714 GTCTGTAATCCCAGTGCTTTTGG + Intronic
1097572652 12:61354593-61354615 GTCTGTAATCCCAGTGCTTTGGG + Intergenic
1097678556 12:62628107-62628129 TCCTGTAATCCCAGTGCTTTGGG - Intergenic
1097895616 12:64822438-64822460 GTCTGTAATCCCAGTGCTTTGGG - Intronic
1097935432 12:65244686-65244708 ACCTATAATCCCAGTGCTTTGGG + Intronic
1097995875 12:65887459-65887481 TACCATAATCCCAGTACTTTGGG + Intronic
1098136640 12:67409912-67409934 TCCTGTAATCCCAGTGCTTTGGG + Intergenic
1098251812 12:68577880-68577902 ATCTGTAATCCCAGTGCTTTGGG + Intergenic
1098261145 12:68672524-68672546 GCCTATAATCCCAGTGCTTTGGG + Intergenic
1098304472 12:69088725-69088747 ATCCATAATCCCAGTACTTTAGG - Intergenic
1098318520 12:69216727-69216749 ACCTATAATCCCAGTGCTTTGGG - Intergenic
1098431127 12:70421230-70421252 ATCTGTAATCCCAGTGCTTTGGG + Intronic
1098754888 12:74348985-74349007 ATCTGTAATCCCAGTGCTTTGGG - Intergenic
1098773599 12:74585612-74585634 GTCTGTAATCCCAGTGCTTTGGG + Intergenic
1098883027 12:75935930-75935952 GTCTATAATCCCAGAGCTTTGGG - Intergenic
1098947115 12:76601336-76601358 GACTATAATCCCAGTGCTTTGGG + Intergenic
1098987508 12:77028449-77028471 TTTACTAATCCCAGTACTTTGGG - Intronic
1099240754 12:80135530-80135552 GCCTATAATCCCAGTGCTTTGGG - Intergenic
1099287640 12:80734368-80734390 TTCTATAATCCCAGCACTTTGGG - Intergenic
1099333857 12:81329061-81329083 ATCTGTAATCCCAGTGCTTTGGG - Intronic
1099623474 12:85035131-85035153 ACCTATAATCCCAGTGCTTTGGG + Intronic
1100246669 12:92765225-92765247 TACTATAATCCCAGTACTTTGGG + Intronic
1100472911 12:94909657-94909679 GTCTGTAATCCCAGTGCTTTGGG - Intronic
1100508455 12:95244134-95244156 ACCTATAATCCCAGTGCTTTGGG + Intronic
1100964383 12:99996895-99996917 TTCTATAATCCTATTGCTTTGGG + Intergenic
1100973264 12:100094368-100094390 GTCTATAATCCCAGTACTTTGGG - Intronic
1101429947 12:104618492-104618514 GTCAATAATCCCAGCACTTTGGG - Intronic
1101512471 12:105405608-105405630 GTCTGTAATCCCAGTGCTTTGGG - Intergenic
1101625686 12:106439113-106439135 CCCTATAATCCCAGTGCTTTGGG + Intronic
1101675349 12:106912099-106912121 TCCTGTAATCCCAGTGCTTTGGG - Intergenic
1101846949 12:108370285-108370307 GTCTTTAATCCCAGTGCTTTGGG + Intergenic
1101925989 12:108971791-108971813 GTCTGTAATCCCAGCGCTGTGGG + Intronic
1102245066 12:111350678-111350700 ACCTATAATCCCAGTGCTTTGGG + Intergenic
1102260049 12:111438017-111438039 TTCGATAAGCTCAGTGCTGAGGG + Intronic
1102305733 12:111803336-111803358 ACCAGTAATCCCAGTGCTTTGGG + Intronic
1102458311 12:113084642-113084664 GCCAGTAATCCCAGTGCTTTGGG - Intronic
1102473526 12:113174216-113174238 TACTATAATCCCAGTACTATGGG + Intronic
1102526769 12:113518151-113518173 GTCAATAATCCCAGCACTATGGG - Intergenic
1102641700 12:114372563-114372585 GTCTATTATCCCAGTGCTTTGGG - Intronic
1102672890 12:114634856-114634878 TTCTGTAATCCCAATGCTTTGGG + Intergenic
1102846708 12:116192725-116192747 TCCAATAATCCCAGCACTTTGGG + Intronic
1102906515 12:116679980-116680002 GTCTGTAATCCCAGTGCTTTGGG - Intergenic
1102985528 12:117274820-117274842 TTCAATAAACACAGGGTTGTAGG - Intronic
1103106626 12:118232644-118232666 ATCTATAATCCCAGTGCTTTGGG + Intronic
1103113265 12:118301584-118301606 TCCTATAATCCCAGTCCTTTGGG + Intronic
1103116670 12:118339791-118339813 TTCTGTAATCCCAGCGCTTTGGG - Intronic
1103225720 12:119285616-119285638 TTCAATCACTCCAGGGCTGTTGG + Intergenic
1103330754 12:120152286-120152308 GCCTATAATCCCAGTGCTTTAGG - Intronic
1103330770 12:120152534-120152556 GCCTATAATCCCAGTGCTTTAGG - Intronic
1103339306 12:120212838-120212860 CTAAATAATCCCAGCCCTGTGGG - Intronic
1103388288 12:120551243-120551265 ATCTATAATCCCAGTGCTTTAGG - Intronic
1103430666 12:120882767-120882789 ATCTGTAAACCCAGTGCTGTGGG + Intronic
1103837625 12:123835882-123835904 TCCTGTAATCCCAGTGCTTTGGG - Intronic
1104002359 12:124868286-124868308 GCCTATAATCCCAGTGCTTTTGG + Intronic
1104010124 12:124924496-124924518 GTCCATAATCCCAGTGCTTTAGG + Intergenic
1104262734 12:127199343-127199365 GCCTATAATCCCAGTGCTTTGGG - Intergenic
1104688097 12:130803239-130803261 ATGTATAATCCCAGTGCTTTGGG + Intronic
1105271497 13:18880419-18880441 GTCAATAATCCCAGCACTCTGGG + Intergenic
1105336091 13:19470783-19470805 TTCTATAATCCCAGCACTTTGGG - Intronic
1105457763 13:20557002-20557024 GTCTATAATCCCAGTGCTTTGGG - Intergenic
1105567124 13:21560675-21560697 TGCAATAATCCCAATGGGGTAGG - Intronic
1105604262 13:21913599-21913621 GTCTGTAATCCCAGTGCTTTGGG + Intergenic
1106022600 13:25929597-25929619 GCCAGTAATCCCAGTGCTTTGGG + Intronic
1106023574 13:25936926-25936948 TTCAATAAGCGGAGGGCTGTAGG - Intronic
1106177829 13:27346519-27346541 ATCTATAATCCCAGTTCTTTGGG + Intergenic
1106192030 13:27462030-27462052 TTCTATAATCCCAGTGCTTTGGG - Intergenic
1106255884 13:28021684-28021706 GTCTGTAATCCCAGTGCTTTTGG - Intronic
1106986507 13:35358281-35358303 TCCTATAACCCCAGTACTGTGGG - Intronic
1107403380 13:40090768-40090790 ACCCATAATCCCAGTGCTCTGGG - Intergenic
1107653787 13:42571626-42571648 TTCTATAATCCCAGCACTTTGGG - Intronic
1107908101 13:45080462-45080484 TTATAAAATCCCAGTGCTTTGGG - Intergenic
1108219065 13:48215141-48215163 TCCCATAATCCCTGTGTTGTGGG + Intergenic
1108285156 13:48899267-48899289 GTCTGTAATCCCAGTGCTTTGGG - Intergenic
1108369728 13:49756303-49756325 TCAAGTAATCCCAGTGCTTTGGG + Intronic
1108456016 13:50614523-50614545 GTCTATAATCCCAGTGCTTTGGG + Intronic
1108489609 13:50968154-50968176 TTCTGTAATCCCAGTACTTTGGG + Intronic
1108508630 13:51135379-51135401 GCCTATAATCCCAGTGCTTTGGG + Intergenic
1108562806 13:51663035-51663057 GTCTGTAATCCCAGTGTTGTAGG + Intronic
1109059707 13:57599417-57599439 ATCTGTAATCCCAGTGCTTTGGG + Intergenic
1109120308 13:58448099-58448121 GTCTATAATCCCAGTGCTTTGGG - Intergenic
1109327266 13:60882975-60882997 TCCTTTAATCCCAGTGCTTTAGG + Intergenic
1109336082 13:60996236-60996258 TTAAATAATTCCATTACTGTAGG - Intergenic
1109615290 13:64826974-64826996 GTCTGTAATCCCAGTGCTTTGGG - Intergenic
1110162356 13:72393612-72393634 TTCAATAATCCCACTACTACTGG + Intergenic
1110471213 13:75862249-75862271 GTCTATAATCCCAGTGCTTTGGG - Intergenic
1110525551 13:76532378-76532400 TTGAATAATAACAGTGCTCTCGG + Intergenic
1110903793 13:80860246-80860268 ACCTGTAATCCCAGTGCTGTGGG - Intergenic
1111113114 13:83741621-83741643 TCCAGTAATCCCAGTGCTTTTGG + Intergenic
1111117764 13:83803550-83803572 ATCCATAATCCCAGTGTTTTGGG + Intergenic
1111400780 13:87732250-87732272 GTCTATAATCCCAGTACTTTGGG + Intergenic
1111422726 13:88036677-88036699 GCCTATAATCCCAGTGCTTTGGG - Intergenic
1112229309 13:97572151-97572173 GCCTATAATCCCAGTGCTTTGGG + Intergenic
1112260432 13:97873289-97873311 ATCTATAATCCCAGAGCTTTGGG + Intergenic
1112278576 13:98043382-98043404 GCCTATAATCCCAGTGCTTTGGG - Intergenic
1112357854 13:98689707-98689729 ACCCATAATCCCAGTGCTTTGGG - Intronic
1112360598 13:98714395-98714417 TACAATAATCCCAGCACTTTGGG + Intronic
1112446533 13:99469674-99469696 GCCTATAATCCCAGTGCTTTGGG + Intergenic
1112688443 13:101860699-101860721 GCCTATAATCCCAGTGCTTTGGG - Intronic
1112808788 13:103192935-103192957 TTCATTAATGGCTGTGCTGTAGG + Intergenic
1112876603 13:104049129-104049151 TCCAATAATCCCAGCACTTTGGG + Intergenic
1112940735 13:104858681-104858703 GCCCATAATCCCAGTGCTTTGGG + Intergenic
1112987673 13:105471182-105471204 TTCTATAATCCCAGCACTTTGGG - Intronic
1113203443 13:107891373-107891395 TTCCATAATCCCAGCACTTTGGG - Intergenic
1113589011 13:111485004-111485026 TTCAAAGATCCCAGTGTTGGGGG + Intergenic
1114338060 14:21713607-21713629 ACCTATAATCCCAGTGCTTTGGG - Intergenic
1114492441 14:23111814-23111836 GTCTGTAATCCCAGTGCTTTGGG - Intergenic
1114719685 14:24867935-24867957 GTCTATAATCCCAGTACTTTGGG + Intronic
1114772930 14:25449736-25449758 TCCTATAATCCCAGTACTGTGGG + Intergenic
1114809860 14:25885596-25885618 CTCACTAAACCCAGTGCAGTTGG - Intergenic
1114955949 14:27819528-27819550 GCCTATAATCCCAGTGCTTTGGG + Intergenic
1115210778 14:30965818-30965840 ATCTGTAATCCCAGTGCTTTGGG + Intronic
1115218821 14:31039125-31039147 ATCTGTAATCCCAGTGCTTTGGG - Intronic
1115229658 14:31146534-31146556 TTCAAGCATAGCAGTGCTGTTGG + Intronic
1115450738 14:33544265-33544287 GCCTATAATCCCAGTGCTTTGGG - Intronic
1115569782 14:34655572-34655594 GCCTATAATCCCAGTGCTTTGGG - Intergenic
1115575663 14:34708424-34708446 ACCTATAATCCCAGTGCTTTGGG + Exonic
1115938492 14:38582591-38582613 GTCTGTAATCCCAGTGCTTTGGG + Intergenic
1116000664 14:39239284-39239306 GCCTATAATCCCAGTGCTTTGGG + Intronic
1116196914 14:41739124-41739146 TTCCATAATCCCAGCACTTTGGG + Intronic
1116202441 14:41815476-41815498 ATCTATAATCACAGTGCTTTGGG + Intronic
1116242480 14:42362978-42363000 CTCTGTAATCCCAGTGCTTTGGG - Intergenic
1116445131 14:45000256-45000278 GCCTATAATCCCAGTGCTTTGGG - Intronic
1116899724 14:50350168-50350190 GTCTATAATCCCAGTGTTTTGGG - Intronic
1117147548 14:52850235-52850257 GTCTGTAATCCCAGTGCTTTGGG - Intergenic
1117304051 14:54456172-54456194 ATCTATAATCCCCGTGCTTTGGG - Intergenic
1117399819 14:55348626-55348648 ACCTATAATCCCAGTGCTTTGGG - Intronic
1117601079 14:57375267-57375289 GGCCATAATCCCAGTGCTTTGGG - Intergenic
1117706853 14:58478589-58478611 TCCTGTAATCCCAGTGCTTTGGG - Intronic
1117726843 14:58683059-58683081 ATCTATAATCCCAGTGCTTTGGG - Intergenic
1117925069 14:60769922-60769944 TCCTATAACCCCAGTGCTTTGGG - Intronic
1117927127 14:60793630-60793652 GCCTATAATCCCAGTGCTTTGGG - Intronic
1117943862 14:60997409-60997431 ATCTATAATCCCAGTACTTTGGG - Intronic
1118111571 14:62727103-62727125 GCCTATAATCCCAGTGCTTTGGG + Intronic
1118153145 14:63211338-63211360 ATCTGTAATCCCAGTGCTTTGGG + Intronic
1118545833 14:66887328-66887350 ACCTATAATCCCAGTGCTTTGGG + Intronic
1118727586 14:68640059-68640081 TCCTATAATCCCAGTACTTTGGG - Intronic
1118733240 14:68684054-68684076 GCCTATAATCCCAGTGCTTTGGG + Intronic
1119127705 14:72143106-72143128 ATCTATAATCCCAGCGCTTTGGG + Intronic
1119222054 14:72916797-72916819 ACCTATAATCCCAGTGCTTTGGG + Intergenic
1119307094 14:73616225-73616247 GCCTATAATCCCAGTGCTTTGGG - Intronic
1119367975 14:74111559-74111581 ACCTATAATCCCAGTGCTTTGGG - Intronic
1119394368 14:74315437-74315459 GCCTATAATCCCAGTGCTTTGGG + Intronic
1119426285 14:74536584-74536606 TGCCTTAATCCCAGTGCTTTGGG + Intronic
1119471238 14:74900983-74901005 GTCCATAATCCCAGCGCTTTGGG - Intronic
1119474988 14:74922036-74922058 GTCTATAATCCCAGCACTGTGGG - Exonic
1120335072 14:83144333-83144355 GTCTATAATCCCAGCGCTTTGGG + Intergenic
1120551495 14:85878182-85878204 ATCTGTAATCCCAGTGCTTTGGG + Intergenic
1120785691 14:88533621-88533643 ATCTGTAATCCCAGTGCTTTGGG + Intronic
1120967830 14:90183346-90183368 GCCCATAATCCCAGTGCTTTGGG + Intronic
1121293740 14:92799222-92799244 GCCCATAATCCCAATGCTGTGGG - Intronic
1121295594 14:92819380-92819402 ACCTGTAATCCCAGTGCTGTGGG + Intronic
1121365008 14:93301093-93301115 GTCTATAATCCCAGTGCTTTGGG + Intronic
1121370694 14:93355590-93355612 ATCTATAATCCCAGTACTTTGGG - Intronic
1121971405 14:98359755-98359777 GTCTATAATCCCAGTACTTTGGG - Intergenic
1202941941 14_KI270725v1_random:157745-157767 TTGAAAAATTCCATTGCTGTTGG - Intergenic
1123715324 15:23025159-23025181 ACCTGTAATCCCAGTGCTGTGGG - Intronic
1123980862 15:25601313-25601335 GCCTATAATCCCAGTGCTTTGGG + Intergenic
1124030583 15:26007265-26007287 ATCTGTAATCCCAGTGCTTTGGG + Intergenic
1124232301 15:27956088-27956110 ATCTATAATCCCAGTACTTTGGG + Intronic
1124503161 15:30248441-30248463 GTCTATTATCCCAGTGCTTTGGG + Intergenic
1124740394 15:32290205-32290227 GTCTATTATCCCAGTGCTTTGGG - Intergenic
1124927721 15:34087894-34087916 ACCTATAATCCCAGTGCTTTGGG + Intronic
1124963564 15:34416538-34416560 ATCTATAATCTCAGTGCTTTGGG + Intronic
1124980183 15:34562764-34562786 ATCTATAATCTCAGTGCTTTGGG + Intronic
1125543217 15:40484335-40484357 ACCTATAATCCCAGTGCTCTGGG - Intergenic
1125561843 15:40639813-40639835 ATCTATAATCCCAGTGCTTTGGG + Intronic
1125576420 15:40758660-40758682 GTCAACAATCCCACTACTGTTGG - Intergenic
1125586231 15:40822223-40822245 TCCTATAATCCCAGTACTTTGGG + Intronic
1125670963 15:41472464-41472486 GTCAATAATCCCAGCACTTTGGG - Intronic
1125732890 15:41904049-41904071 CACAAAAATCCCAGTGCTGCTGG + Intronic
1125804239 15:42479112-42479134 GTCTATAATCCCAGTACTTTGGG + Intronic
1126019441 15:44385816-44385838 ACCTATAATCCCAGTGCTTTTGG - Intronic
1126044522 15:44626135-44626157 GTCTATAATCCCAGTGCTTTGGG - Intronic
1126141054 15:45439081-45439103 ATCAGTAATCCCAGCACTGTGGG + Intronic
1126291509 15:47085720-47085742 TTGAAAAATTCCATTGCTGTTGG + Intergenic
1126353190 15:47766602-47766624 TTCCATAACCACAGTGCTGAAGG + Exonic
1126435986 15:48638157-48638179 TCCTGTAATCCCAGTGCTTTGGG - Intronic
1126761990 15:51977794-51977816 TCCTATAATCCCAGTACTTTAGG - Intronic
1126909116 15:53399659-53399681 TTCCATAATCCCAGGTCTGATGG - Intergenic
1126936550 15:53715695-53715717 GCCTATAATCCCAGTGCTTTGGG + Intronic
1127072699 15:55301903-55301925 GTCTATAATCCCAATGCTTTGGG - Intronic
1127084540 15:55412868-55412890 GCCTGTAATCCCAGTGCTGTGGG + Intronic
1127111603 15:55678503-55678525 GCCAGTAATCCCAGTGCTTTGGG - Intronic
1127213321 15:56798396-56798418 ACCTATAATCCCAGTGCTTTGGG + Intronic
1127276554 15:57450534-57450556 TGCAGTAATCCCAGTACTTTGGG - Intronic
1127434562 15:58944283-58944305 ACCTATAATCCCAGTGCTATGGG - Intronic
1127800638 15:62474381-62474403 GCCTATAATCCCAGTGCTTTGGG + Intronic
1127820728 15:62653464-62653486 TTCTATAATCCCAGTATTTTGGG + Intronic
1127941813 15:63705768-63705790 TACAATAATCCCAGCACTTTGGG + Intronic
1128022194 15:64401529-64401551 ATCTGTAATCCCAGTGCTTTGGG - Intronic
1128232806 15:66047492-66047514 TTTATTATTCCCAGTGCTGTAGG - Intronic
1128391268 15:67184364-67184386 ACCAATAATCCCAGAGCTTTAGG - Intronic
1128958975 15:71980103-71980125 GCCTATAATCCCAGTGTTGTGGG - Intronic
1128995679 15:72292766-72292788 GCCTATAATCCCAGTGCTTTGGG + Intronic
1129031992 15:72625842-72625864 ACCTATAATCCCAGTGCTTTGGG + Intergenic
1129109998 15:73331702-73331724 ACCAGTAATCCCAGTGCTTTAGG - Intronic
1129358639 15:75010551-75010573 GCCTATAATCCCAGTGCTTTGGG + Intronic
1129406763 15:75324585-75324607 ACCTATAATCCCAGTGCTTTGGG + Intergenic
1129442468 15:75591638-75591660 ACCTATAATCCCAGTGCTTTGGG - Intergenic
1129561658 15:76577184-76577206 ACCTATAATCCCAGTGCTTTGGG + Intronic
1129610484 15:77051266-77051288 GTCTATAATCCCAGTACTTTGGG + Intronic
1129967828 15:79752560-79752582 ACCTATAATCCCAGTGCTTTGGG - Intergenic
1130088141 15:80795672-80795694 ACCTATAATCCCAGTGCTTTGGG + Intronic
1130126381 15:81097365-81097387 TTCTATAATCCCAGCACTTTGGG - Intronic
1130343407 15:83019448-83019470 ATCTATAATCCCAGTACTTTGGG - Intronic
1130388289 15:83432347-83432369 ACCTATAATCCCAGTGCTTTGGG + Intergenic
1130508188 15:84566444-84566466 GCCAATAATCCCAGTACTTTGGG + Intergenic
1130545051 15:84850644-84850666 GTCTAGAATCCCAGTGCTTTGGG - Intronic
1130585927 15:85182223-85182245 ACCTATAATCCCAGTGCTTTGGG - Intergenic
1130640112 15:85664939-85664961 GCCTATAATCCCAGTGCTTTGGG + Intronic
1130851312 15:87796625-87796647 GTCAGTAATCCCAGTGCTTTGGG - Intergenic
1131025611 15:89138954-89138976 TTCTATAATTCCAGCACTGTGGG + Intronic
1131158495 15:90089585-90089607 TCAAATGATCCCAGTGCTGTGGG + Intronic
1131267589 15:90926650-90926672 GTCTATAATCCCAGTACTTTGGG + Intergenic
1131285198 15:91051118-91051140 ACCTATAATCCCAGTGCTTTGGG - Intergenic
1131330675 15:91496211-91496233 GTCTATAATCCCAGTACTTTCGG - Intergenic
1131491069 15:92863383-92863405 GTCTATAATCCCAGTACTTTGGG + Intergenic
1131721710 15:95176071-95176093 GCCTATAATCCCAGTGCTTTGGG - Intergenic
1131734141 15:95314109-95314131 TCCTATAATCCCAGTACTTTGGG - Intergenic
1131907088 15:97154615-97154637 TTCCATAATCCCAGCACTTTGGG + Intergenic
1132077708 15:98836271-98836293 ACCTATAATCCCAGTGCTCTGGG + Intronic
1132131183 15:99281374-99281396 TCCCATAATCCCAGAGCTTTGGG - Intronic
1132221778 15:100110521-100110543 TTCTATAATCCCAGCACTTTGGG - Intronic
1132821663 16:1875641-1875663 GCCTATAATCCCAGTGCTTTGGG - Intronic
1132822072 16:1878872-1878894 GTCTATAATCCCAGTACTTTGGG + Intronic
1133071638 16:3250347-3250369 GCCTATAATCCCAGTGCTTTGGG + Intronic
1133094317 16:3431000-3431022 GTCTGTAATCCCAGTGCTTTGGG - Intronic
1133166638 16:3952653-3952675 GTCTATAATCCCAGTGCTTTAGG - Intergenic
1133190273 16:4128635-4128657 GCCTATAATCCCAGTGCTTTGGG + Intergenic
1133276790 16:4643217-4643239 GCCTATAATCCCAGTGCTCTGGG - Intronic
1133417078 16:5615288-5615310 TTCTGTAATCCCAGTGCTTTGGG - Intergenic
1133552001 16:6865260-6865282 GTCTGTAATCCCAGTACTGTGGG - Intronic
1133601193 16:7341913-7341935 TTCAACACACCCACTGCTGTGGG + Intronic
1134074646 16:11282086-11282108 ATCTGTAATCCCAGTGCTTTGGG - Intronic
1134126622 16:11620591-11620613 GTCTGTAATCCCAGTGCTTTGGG - Intronic
1134455152 16:14389998-14390020 ATCAATAATCCCAGCACTTTGGG - Intergenic
1134469589 16:14511946-14511968 ACCTATAATCCCAGTGCTTTGGG - Intronic
1134480376 16:14614005-14614027 TCCTATAATCCCAGAGCTTTAGG + Intronic
1134542890 16:15083139-15083161 TTCACTAATCCCAGCACTTTGGG + Intronic
1134582850 16:15386217-15386239 GTCTATAATCCCAGTGCTTTGGG + Intergenic
1134585976 16:15411384-15411406 GTCTATAATCCAAGTGCTTTGGG + Intronic
1134640202 16:15823884-15823906 AACTATAATCCCAGTGCTTTGGG - Intronic
1135048766 16:19175392-19175414 ATCTGTAATCCCAGTGCTTTGGG + Intronic
1135177505 16:20243746-20243768 ATCCATAATCCCAGTGCTGAGGG + Intergenic
1135252369 16:20911855-20911877 TCCTATAATCCCAGTACTTTGGG - Intronic
1135306474 16:21371460-21371482 GCCTATAATCCCAGTGCTTTGGG + Intergenic
1135398828 16:22151610-22151632 GCCTATAATCCCAGTGCTTTGGG + Intronic
1135404323 16:22187355-22187377 ACCTATAATCCCAGTGCTTTGGG + Intronic
1135409321 16:22221225-22221247 ATCAGTAATCCTAGTGCTTTGGG + Intronic
1135433408 16:22406865-22406887 TATAATAATCCCAGTACTTTTGG + Intronic
1135631985 16:24042994-24043016 ATCTATAATCCCAGCGCTTTGGG - Intronic
1135648396 16:24184202-24184224 GCCCATAATCCCAGTGCTTTGGG + Intronic
1135666980 16:24344170-24344192 ATCTGTAATCCCAGTGCTTTGGG + Intronic
1135688768 16:24519593-24519615 ATCTGTAATCCCAGTGCTTTGGG - Intergenic
1135701330 16:24635032-24635054 TTCTGTAATCCCAGTGCTCTGGG - Intergenic
1135804767 16:25532942-25532964 GTCTATTATCCCAGTGCTTTGGG - Intergenic
1135805581 16:25539432-25539454 TCCTGTAATCCCAGTGCTTTGGG - Intergenic
1135811636 16:25592426-25592448 TTCTGTAATCCCAGTACTTTGGG + Intergenic
1135976911 16:27114475-27114497 ATCTATAATCCCAGTGCTTCGGG + Intergenic
1136074879 16:27810217-27810239 GCCTATAATCCCAGTGCTTTGGG + Intronic
1136151025 16:28349292-28349314 ATAAATAATCCCAGTACTTTGGG + Intronic
1136167259 16:28463132-28463154 ATAAATAATCCCAGTACTTTGGG + Intronic
1136195718 16:28651884-28651906 ATAAATAATCCCAGTACTTTGGG - Intronic
1136212056 16:28766009-28766031 ATAAATAATCCCAGTACTTTGGG - Intronic
1136256775 16:29045937-29045959 ATAAATAATCCCAGTACTTTGGG - Intronic
1136315173 16:29450182-29450204 GTCTATAATCCCAGCACTGTGGG + Intronic
1136371370 16:29838566-29838588 GACTATAATCCCAGTGCTTTGGG + Intronic
1136429750 16:30189521-30189543 GTCTATAATCCCAGCACTGTGGG + Intergenic
1136455310 16:30376805-30376827 GCCTATAATCCCAGTGCTTTGGG + Intronic
1136562688 16:31049758-31049780 GCCTATAATCCCAGTGCTTTGGG + Intergenic
1136611205 16:31366773-31366795 GTCTGTAATCCCAGTGCTTTGGG - Intronic
1136929625 16:34407430-34407452 GCCTATAATCCCAGTGCTTTGGG + Intergenic
1136974949 16:35004374-35004396 GCCTATAATCCCAGTGCTTTGGG - Intergenic
1137253408 16:46756779-46756801 TGCAATAACCACAGGGCTGTTGG + Intronic
1137272429 16:46910844-46910866 GCCTATAATCCCAGTGCTTTGGG - Intronic
1137277472 16:46945688-46945710 TCCTGTAATCCCAGTGCTTTGGG + Intergenic
1137290368 16:47048507-47048529 GACTATAATCCCAGTGCTCTGGG - Intergenic
1137525680 16:49234276-49234298 CTCTGTAATCCCAGTGCTTTGGG + Intergenic
1137654589 16:50149252-50149274 ACCTATAATCCCAGTGCTTTGGG - Intergenic
1137978967 16:53054266-53054288 TCCGGTAATCCCAGTGCTTTGGG + Intergenic
1138198789 16:55073848-55073870 TCCTGTAATCCCAGTGCTTTGGG + Intergenic
1138367094 16:56489038-56489060 GTCTATAATCCCAGTGCTTTGGG - Intronic
1138527719 16:57618690-57618712 GCCTATAATCCCAGTGCTTTGGG - Intronic
1138572286 16:57883676-57883698 GCCTATAATCCCAGTGCTTTGGG - Exonic
1138654625 16:58483803-58483825 GCCAGTAATCCCAGTGCTTTGGG + Intronic
1138697145 16:58825054-58825076 GCCTATAATCCCAGTGCTGTGGG - Intergenic
1139377175 16:66507152-66507174 TTCACTAATCCCAGTACTTTGGG + Intronic
1139396228 16:66641291-66641313 ACCAGTAATCCCAGTGCTTTGGG - Intronic
1139554005 16:67694557-67694579 GCCTATAATCCCAGTGCTTTGGG - Intronic
1139584020 16:67889720-67889742 GCCTATAATCCCAGTGCTTTGGG + Intergenic
1139608127 16:68034623-68034645 TGCTATAATTCCAGTGCTTTGGG - Intronic
1139695877 16:68674471-68674493 ATCTGTAATCCCAGTGCTTTGGG + Intronic
1139728731 16:68924301-68924323 GCCTATAATCCCAGTGCTTTGGG + Intronic
1139814310 16:69656019-69656041 GCCTATAATCCCAGTGCTTTTGG + Intronic
1139858527 16:70001369-70001391 GTCTATAATCCCAGTGCTTTGGG + Intergenic
1139903068 16:70343280-70343302 ACCTATAATCCCAGTGCTTTTGG + Intronic
1139936376 16:70574440-70574462 ACCTATAATCCCAGTGCTTTGGG - Exonic
1139995738 16:70978451-70978473 TCCTATAATCCCAGTACTTTGGG - Intronic
1140185575 16:72767309-72767331 GCCTATAATCCCAGTGCTTTGGG - Intergenic
1140251438 16:73297923-73297945 ACCTATAATCCCAGTGCTTTGGG + Intergenic
1140366467 16:74385269-74385291 ATAAATAATCCCAGTACTTTGGG - Intronic
1140490106 16:75328241-75328263 GCCTATAATCCCAGTGCTTTGGG - Intronic
1140680918 16:77383798-77383820 GTCTATAATCCCAGCGCTTTGGG - Intronic
1141512536 16:84521989-84522011 ACCTATAATCCCAGTGCTTTGGG - Intronic
1141656616 16:85420125-85420147 GCCTATAATCCCAGTGCTTTGGG + Intergenic
1141711456 16:85701656-85701678 GCCTATAATCCCAGTGCTTTGGG - Intronic
1142021974 16:87789482-87789504 TTCTGTAATCCCAGTGCTTTGGG - Intergenic
1142497144 17:312042-312064 GTCTGTAATCCCAGTGCTTTGGG + Intronic
1142511550 17:397543-397565 GCCTATAATCCCAGTGCTTTAGG - Intergenic
1142551542 17:743552-743574 TGTAATAATCCCAGTGCTTTGGG - Intergenic
1142834989 17:2578798-2578820 ATCTGTAATCCCAGTGCTTTGGG + Intergenic
1143194596 17:5066236-5066258 GTCTGTAATCCCAGTGCTTTGGG + Intergenic
1143443045 17:6990515-6990537 TCCTGTAATCCCAGTGCTTTAGG + Intronic
1144078319 17:11738638-11738660 GCCTATAATCCCAGTGCTTTGGG - Intronic
1144079536 17:11750171-11750193 TCCTATAATCCCAGTGCTTTGGG + Intronic
1144505835 17:15829962-15829984 ATCTGTAATCCCAGTGCTCTGGG - Intergenic
1144555195 17:16275762-16275784 ACCTATAATCCCAGTGCTTTGGG + Intronic
1144558428 17:16301958-16301980 ATCTGTAATCCCAGTGCTTTGGG - Intronic
1144566002 17:16359881-16359903 ACCTATAATCCCAGTGCTTTGGG - Intergenic
1144768842 17:17747803-17747825 GTCTATAATCCCAGTGCTTTGGG + Intronic
1145170009 17:20647894-20647916 ATCTGTAATCCCAGTGCTCTGGG - Intergenic
1145775925 17:27528637-27528659 GTCTGTAATCCCAGTGCTTTGGG + Intronic
1146015239 17:29227884-29227906 TCCTATAATCCCAGTGCTTTGGG + Intergenic
1146131520 17:30280735-30280757 GTCTATAATCCCAGTGCCTTGGG - Intronic
1146287468 17:31583608-31583630 ACCTATAATCCCAGTGCTTTGGG - Intergenic
1146802622 17:35839004-35839026 GCCTATAATCCCAGTGCTTTGGG + Intronic
1147111902 17:38268865-38268887 ATCTATAATCCCAGTACTTTGGG - Intergenic
1147127135 17:38378896-38378918 TGTAATAATCCCAGTACTTTGGG + Intronic
1147205336 17:38833341-38833363 GCCTATAATCCCAGTGCTTTGGG - Intergenic
1147277333 17:39329736-39329758 ATCTGTAATCCCAGTGCTTTGGG + Intronic
1147417045 17:40299636-40299658 GCCCATAATCCCAGTGCTTTGGG + Intronic
1147638326 17:41977829-41977851 ACCTATAATCCCAGTGCTTTGGG + Intronic
1147917065 17:43894677-43894699 GCCTATAATCCCAGTGCTTTGGG + Intronic
1148320578 17:46748369-46748391 GCCTATAATTCCAGTGCTGTGGG - Intronic
1148370797 17:47098704-47098726 TCCTGTAATCCCAGTGCTTTGGG - Intergenic
1148417671 17:47519936-47519958 ATCTATAATCCCAGTACTTTGGG + Intergenic
1148927240 17:51098081-51098103 GCCTATAATCCCAGTGCTTTGGG - Intronic
1148943120 17:51232776-51232798 GTCTATAATCCCAGAACTGTGGG + Intronic
1149502149 17:57161390-57161412 TTCTGTAATCTCAGTGCTCTAGG - Intergenic
1149602715 17:57903677-57903699 CTATATAATCCCAGTGCTTTGGG + Intronic
1149652718 17:58286530-58286552 TTCTATAATCCCAGCACTTTGGG + Intergenic
1149796360 17:59524206-59524228 GTCTATAATCCCAGCGCTTTGGG + Intergenic
1149810723 17:59668295-59668317 TTTAATAATCCCAGTGCTTTGGG + Intronic
1149828983 17:59854717-59854739 GCCTATAATCCCAGTGCTTTAGG + Intergenic
1149831534 17:59876749-59876771 TTCTGTAATCCCAGTGCTTTAGG - Intronic
1150040360 17:61854014-61854036 GCCTATAATCCCAGTGCTTTGGG + Intronic
1150157024 17:62862275-62862297 ACCTATAATCCCAGTGCTCTGGG + Intergenic
1150367669 17:64604684-64604706 GTCTATAATCCCAGCACTGTGGG + Intronic
1150375172 17:64675287-64675309 GCCTATAATCCCAGCGCTGTGGG - Intergenic
1150424046 17:65062984-65063006 GTCTATAATCCCAGCACTGTGGG - Intergenic
1150512515 17:65771753-65771775 GTCTATAATCCCAGTGCTTTGGG + Intronic
1150605897 17:66690571-66690593 TTCTGTAATCCCAGTACTTTGGG + Intronic
1150612533 17:66745419-66745441 TCCTACAATCCCAGTGCTTTGGG + Intronic
1150629196 17:66866392-66866414 TGCTCTAATCCCAGTGCTTTGGG - Intronic
1150678646 17:67266402-67266424 GCCTATAATCCCAGTGCTTTGGG - Intergenic
1150698901 17:67430539-67430561 GCCTATAATCCCAGTGCTCTAGG + Intronic
1150738776 17:67762629-67762651 ACCCATAATCCCAGTGCTTTGGG - Intergenic
1150755142 17:67905445-67905467 ACCTATAATCCCAGTGCTTTGGG + Intronic
1151035360 17:70792592-70792614 TGCTATAATCCCAGTACTTTGGG - Intergenic
1151332230 17:73417142-73417164 ACCTATAATCCCAGTGCTTTGGG + Intronic
1151779593 17:76235747-76235769 TTCTGTAATCCCACTGCTTTGGG + Intronic
1151920832 17:77154209-77154231 ATCTGTAATCCCAGTGCTTTGGG + Intronic
1152074858 17:78152730-78152752 TCCTATAATCCCAGAGCTTTTGG - Intronic
1152116045 17:78387855-78387877 GCCTATAATCCCAGTGCTTTAGG - Intronic
1152537335 17:80958348-80958370 ACCTATAATCCCAGTGCTTTGGG - Intronic
1152619316 17:81353874-81353896 TGCTGTAATCCCAGTGCTTTGGG + Intergenic
1152668373 17:81585725-81585747 ATCTATAATCCCAGCACTGTGGG + Intronic
1153231387 18:2940064-2940086 GTCTGTAATCCCAGTGCTTTGGG + Intronic
1153250688 18:3118591-3118613 TCCTGTAATCCCAGTGCTTTGGG - Intronic
1153339149 18:3956605-3956627 TTCTATAATCCCAGCACTTTGGG - Intronic
1153620599 18:6974040-6974062 TCCTGTAATCCCAGTGCTTTGGG - Intronic
1153700025 18:7683430-7683452 GCCTATAATCCCAGTGCTTTCGG - Intronic
1153925276 18:9830270-9830292 TCCTATAATCCCAGGGCTTTAGG - Intronic
1154237455 18:12619153-12619175 GTCTATAATCCCAGTACTTTGGG - Intronic
1154240987 18:12654075-12654097 TTCTGTAATCCCAGCACTGTGGG + Intronic
1154270758 18:12917193-12917215 GCCTATAATCCCAGTGCTTTGGG + Intronic
1154477494 18:14777680-14777702 AGCCATAATCCCAGTGCTTTGGG + Intronic
1154964340 18:21341630-21341652 ACCTATAATCCCAGTGCTTTGGG - Intronic
1155012475 18:21793520-21793542 GTCTGTAATCCCAGTGCTTTGGG + Intronic
1155066074 18:22270346-22270368 GTCTATAATCCCAGTACTTTGGG - Intergenic
1155147652 18:23097323-23097345 GCCTATAATCCCAGTGCTTTGGG + Intergenic
1155208955 18:23584920-23584942 CACAATAATCCCAGTGCTTTGGG + Intronic
1155268742 18:24118913-24118935 GCCTATAATCCCAGTGCTTTGGG - Intronic
1155480961 18:26286941-26286963 GTCTGTAATCCCAGTGCTTTGGG - Intronic
1155536256 18:26821347-26821369 TCCTATAATCCCACTGCTGTGGG + Intergenic
1155624019 18:27813680-27813702 ACCTATAATCCCAGTGCTTTGGG + Intergenic
1155834167 18:30558065-30558087 TTCTGTAATCCCAGTGCTTTGGG + Intergenic
1155974198 18:32110250-32110272 GCCTATAATCCCAGTGCTTTGGG - Intronic
1156031564 18:32719205-32719227 GCCTATAATCCCAGTGCTTTGGG - Intronic
1156325429 18:36070254-36070276 TTCTATAATCCCAGCACTTTGGG - Intergenic
1156966681 18:43102911-43102933 GTCCATAATCCCAGCGCTTTGGG - Intronic
1157351593 18:46892511-46892533 ACCTATAATCCCAGTGCTTTTGG + Intronic
1157618229 18:49000462-49000484 TCCTATAATCCCAGCACTGTGGG - Intergenic
1157650730 18:49327614-49327636 GTCCGTAATCCCAGTGCTTTGGG - Intronic
1157668977 18:49512395-49512417 GTCTGTAATCCCAGTGCTTTGGG - Intergenic
1157683220 18:49623043-49623065 TTAAAGAATCTCAGTGCTGAAGG - Intergenic
1157809442 18:50684283-50684305 ATCTATAATCCTAGTGCTTTGGG + Intronic
1157820187 18:50761545-50761567 ACCTATAATCCCAGTGCTTTGGG - Intergenic
1157845290 18:50998683-50998705 ATCTATAATTCCAGTGCTTTGGG + Intronic
1158030090 18:52952738-52952760 GCCTATAATCCCAGTGCTTTGGG + Intronic
1158220443 18:55145317-55145339 ATCTATAATCCCAGTACTTTTGG + Intergenic
1158414425 18:57236972-57236994 GCCTATAATCCCAGTGCTTTGGG + Intergenic
1158491346 18:57912317-57912339 TCCTGTAATCCCAGTGCTTTGGG - Intergenic
1158581575 18:58688889-58688911 TCCTATAATCCCAGTGCTTTGGG + Intronic
1158691700 18:59667012-59667034 GCCCATAATCCCAGTGCTTTGGG + Intronic
1159657135 18:71045014-71045036 TTTAATAATCCCAAGGATGTAGG + Intergenic
1160766253 19:809630-809652 CTTTATAATCCCAGTACTGTGGG + Intronic
1160796693 19:948966-948988 TCCCATAATCCCAGTACTTTGGG - Intronic
1160925281 19:1541665-1541687 CACAGTAATCCCAGTGCTTTGGG - Intergenic
1160961367 19:1722800-1722822 GTCTGTAATCCCAGTGCTTTGGG + Intergenic
1161054588 19:2183882-2183904 GCCTATAATCCCAGTGCTTTGGG - Intronic
1161136907 19:2625329-2625351 ACCTATAATCCCAGTGCTTTGGG - Intronic
1161199676 19:3007507-3007529 TCCTGTAATCCCAGTGCTTTGGG - Intronic
1161215414 19:3092808-3092830 ATCTATAATCCCAGCGCTTTGGG + Intergenic
1161292768 19:3504251-3504273 GCCTATAATCCCAGTGCTTTGGG - Intergenic
1161362460 19:3858556-3858578 GCCTATAATCCCAGTGCTTTGGG + Intronic
1161368759 19:3897034-3897056 CTCAGTAATCCCAGCGCTTTGGG - Intronic
1161408985 19:4106077-4106099 TGCTTTAATCCCAGTGCTTTGGG - Intronic
1161452965 19:4356897-4356919 GCCTATAATCCCAGTGCTTTGGG - Intronic
1161640977 19:5422872-5422894 GTCTGTAATCCCAGTGCTTTGGG - Intergenic
1161765305 19:6204599-6204621 GTCTGTAATCCCAGTGCTTTGGG + Intergenic
1161847958 19:6723091-6723113 TTCTATAATCCCAGCACTCTGGG - Intronic
1162055001 19:8057277-8057299 GCCTATAATCCCAGTGCTTTGGG - Intronic
1162313808 19:9924516-9924538 GCCCATAATCCCAGTGCTTTGGG - Intronic
1162332684 19:10039806-10039828 ATCTGTAATCCCAGTGCTTTGGG + Intergenic
1162673872 19:12283753-12283775 ATCTATAATCCCAGTACTGTGGG + Intronic
1162800282 19:13106329-13106351 TCCTATAATCCCAGTGCTTTGGG - Intronic
1163173618 19:15549703-15549725 GTCTGTAATCCCAGTGCTTTGGG + Intronic
1163402926 19:17105220-17105242 TTACATAATCCCAGTGCACTGGG + Intronic
1163405635 19:17120381-17120403 ATCTGTAATCCCAGTGCTTTGGG + Intronic
1163485689 19:17584112-17584134 TCCTATAATCCCAATGCTTTGGG + Intergenic
1163520061 19:17786791-17786813 GTCTGTAATCCCAGTGCTTTGGG + Intronic
1163520132 19:17787284-17787306 GTCTGTAATCCCAGTGCTTTGGG + Intronic
1163562055 19:18025247-18025269 TCCTATAATCCCAGTACTTTGGG - Intergenic
1163564618 19:18043303-18043325 GTCTATAATCCCAGCGCTTTGGG + Intergenic
1163801793 19:19370257-19370279 GTCTATAATCCCAGCACTGTAGG + Intergenic
1163952321 19:20600870-20600892 GCCAGTAATCCCAGTGCTTTGGG - Intronic
1164108280 19:22129222-22129244 GCCTATAATCCCAGTGCTTTGGG - Intergenic
1164163055 19:22643002-22643024 TCCTGTAATCCCAGTGCTTTGGG + Intronic
1164403939 19:27924988-27925010 GTCTATAATCCCAGTACTTTAGG - Intergenic
1164594071 19:29522167-29522189 TCCTATAATCCCAGTGCTTTGGG + Intergenic
1164841233 19:31393922-31393944 GCCTATAATCCCAGTGCTTTGGG - Intergenic
1165051294 19:33143068-33143090 GTCTGTAATCCCAGTGCTTTGGG + Intronic
1165169757 19:33883604-33883626 ATCTGTAATCCCAGTGCTTTGGG - Intergenic
1165263868 19:34644291-34644313 ACCAGTAATCCCAGTGCTTTGGG - Intronic
1165317280 19:35064501-35064523 ATCTGTAATCCCAGTGCTTTGGG + Intronic
1165320029 19:35079559-35079581 GTCTGTAATCCCAGTGCTTTGGG + Intergenic
1165327369 19:35122072-35122094 TAATATAATCCCAGTGCTTTGGG - Intronic
1165380785 19:35478166-35478188 ATCTATAATCCTAGTGCTTTGGG - Intergenic
1165707531 19:37987185-37987207 ATCTATAATCCCAGTGCTTTGGG - Intronic
1165733782 19:38163228-38163250 GCCTATAATCCCAGTGCTTTAGG + Intronic
1166058329 19:40307637-40307659 TCCTGTAATCCCAGTACTGTGGG - Intergenic
1166083587 19:40460366-40460388 TATTATAATCCCAGTGCTTTGGG + Intronic
1166113119 19:40635319-40635341 ACCTATAATCCCAGTGCTTTGGG + Intergenic
1166129346 19:40736762-40736784 GCCTATAATCCCAGTGCTTTGGG - Intronic
1166552269 19:43673986-43674008 GTCTATAATACCAGTGCTTTGGG + Intergenic
1166553325 19:43681568-43681590 CTCTGTAATCCCAGTGCTCTGGG - Intergenic
1166646741 19:44537772-44537794 ACCTATAATCCCAGTGCTTTGGG - Intergenic
1166701871 19:44886779-44886801 GTCTATAATCCCAGTACTTTGGG + Intronic
1166706695 19:44912018-44912040 TCCTGTAATCCCAGTGCTTTGGG - Intergenic
1166874420 19:45888677-45888699 ATCTATAATCCCAGTACTTTGGG + Intergenic
1166886983 19:45967680-45967702 TTCAAAAATCCCAGCACTTTGGG + Intronic
1167147274 19:47689668-47689690 TATAATAATCCCAGTACTTTGGG - Intronic
1167241190 19:48344144-48344166 ACCTATAATCCCAGTGCTTTGGG - Intronic
1167331780 19:48860535-48860557 TCCAGTAAACCCAGTGCTTTGGG + Intronic
1168109703 19:54185315-54185337 TTGTATAATCCCAGCGCTTTGGG - Intronic
1168188764 19:54722558-54722580 TTCAATAATCCTAGCACTTTGGG + Intergenic
1168394155 19:56034027-56034049 GCCTATAATCCCAGTGCTCTGGG - Intronic
1168595817 19:57675539-57675561 TCCTATAATCCCAGAACTGTGGG - Intronic
925175034 2:1776866-1776888 TGCCGTAATCCCAGTGCTTTGGG - Intergenic
925175922 2:1783548-1783570 GTCTATAATCCCAGCACTGTGGG - Intergenic
925600145 2:5600032-5600054 TTCTATAATCCCAGCACTTTGGG + Intergenic
925993782 2:9275327-9275349 TACTATAATACCAGTGCTTTGGG - Intronic
926239418 2:11073712-11073734 TTCAATCAGCCCAATGCTGAAGG + Intergenic
926285754 2:11486413-11486435 GCCTATAATCCCAGTGCTCTAGG - Intergenic
926287056 2:11497054-11497076 ATCTGTAATCCCAGTGCTTTGGG - Intergenic
926670510 2:15573090-15573112 AGCTATAATCCCAGTGCTTTGGG - Intergenic
926932099 2:18050950-18050972 GTCCATAATCCCAGTACTTTGGG - Intronic
927180272 2:20441097-20441119 ACCTGTAATCCCAGTGCTGTGGG + Intergenic
927601531 2:24446500-24446522 GCCTATAATCCCAGTGCTTTGGG - Intergenic
927862168 2:26566967-26566989 TTCTATAATCCCAGCACTTTGGG - Intronic
928000006 2:27515533-27515555 GCCTATAATCCCAGTGCTTTGGG - Intronic
928052375 2:28012649-28012671 TTCAATAATTTCAGTGTTCTTGG + Intronic
928104882 2:28463201-28463223 TCCTTTAATCCCAGTGCTTTGGG - Intronic
928536035 2:32242785-32242807 TCCTATAATCCCCGTGCTTTGGG + Intronic
929113659 2:38426249-38426271 TTCTGTAATCCCAGTGCTTTGGG + Intergenic
929135874 2:38623489-38623511 TCCCATAATCCCAGCACTGTGGG + Intergenic
929187297 2:39108627-39108649 TCCTGTAATCCCAGTGCTTTGGG + Intronic
929274123 2:40006816-40006838 GTCTAGAATCCCAGTGCTTTGGG - Intergenic
929418431 2:41767306-41767328 GCCTGTAATCCCAGTGCTGTGGG - Intergenic
929592619 2:43157128-43157150 GTCTATAATCCCAGCACTGTGGG + Intergenic
929647670 2:43644859-43644881 TTAAATAATCTCAGTACTTTGGG + Intronic
929805283 2:45139435-45139457 TACAATAATTCCAGTAATGTAGG - Intergenic
929879781 2:45825622-45825644 TCCTATAATCCCAGCGCTTTGGG + Intronic
930068090 2:47343106-47343128 TTCTGTAATCCCAGTACTGTGGG - Intergenic
930074613 2:47396557-47396579 GTCTATAATCCCAGTACTTTGGG + Intergenic
930184173 2:48395143-48395165 GCCTATAATCCCAGTGCTTTGGG - Intergenic
930349737 2:50235412-50235434 TTCAATAATGGCTGTGCTGAGGG + Intronic
930677674 2:54221779-54221801 GTCTATAATCCCAGCACTGTGGG - Intronic
930707129 2:54515784-54515806 ATCTGTAATCCCAGTGCTTTGGG - Intronic
931204026 2:60129727-60129749 TCCTGTAATCCCAGTGCTTTGGG + Intergenic
931310288 2:61072310-61072332 ATCAGTAATCCCAGTACTTTAGG + Intronic
931344221 2:61431484-61431506 GTCTGTAATCCCAGTGCTTTGGG - Intronic
931346104 2:61448212-61448234 GTCTATAATCCCAGTACTTTGGG + Intronic
931392538 2:61856402-61856424 ATCTGTAATCCCAGTGCTTTGGG - Intergenic
931544964 2:63372862-63372884 TTCTATAATCCCAGCACTTTGGG + Intronic
931837672 2:66116260-66116282 GTCAACAAACCCATTGCTGTTGG + Intergenic
932016789 2:68036786-68036808 GTCTATAATCCCAGCGCTGTGGG - Intergenic
932067599 2:68582947-68582969 TTCAATTATCTCAGTGAAGTAGG - Intronic
932262657 2:70340122-70340144 GCCCATAATCCCAGTGCTTTGGG - Intergenic
932835486 2:75031957-75031979 GTCTGTAATCCCAGTGCTTTGGG + Intergenic
932899976 2:75686481-75686503 GCCTATAATCCCAGTGCTTTGGG + Intronic
933217347 2:79645244-79645266 GTCTATAATCCCAGTACTTTGGG - Intronic
933301416 2:80545285-80545307 ACCTATAATCCCAGTGCTCTGGG + Intronic
933416078 2:81987777-81987799 GCCTATAATCCCAGTGCTTTGGG - Intergenic
933441713 2:82323112-82323134 GTCTGTAATCCCAGTGATGTGGG + Intergenic
933890395 2:86763416-86763438 TGCAAAAAGCACAGTGCTGTTGG + Intronic
934091389 2:88553583-88553605 TTCTATAATCCCAGCACTTTGGG - Intergenic
934587242 2:95512409-95512431 GCCTGTAATCCCAGTGCTGTGGG - Intergenic
935033458 2:99344694-99344716 ATCTATAATCCCAGTACTTTGGG - Intronic
935050307 2:99519411-99519433 ATCCATAATCCCAGTGCTTTGGG + Intergenic
935063966 2:99632272-99632294 TTCTGTAATCCCAGCACTGTGGG - Intronic
935099534 2:99979740-99979762 GCCTATAATCCCAGTGCTTTGGG - Intronic
935201552 2:100861124-100861146 AGCTATAATCCCAGTGCTTTGGG - Intronic
935229175 2:101081033-101081055 TCCCATAATCCCAGTACTTTGGG - Intronic
936030212 2:109064763-109064785 TTCAATAACCTTAGTTCTGTGGG - Intergenic
936121603 2:109750979-109751001 TCCAATAATCCCAGCACTTTGGG - Intergenic
936223094 2:110620495-110620517 TCCAATAATCCCAGCACTTTGGG + Intergenic
936605502 2:113948407-113948429 TCCTATAATCCCAGCGCTTTGGG - Intronic
936605639 2:113949820-113949842 ACCTATAATCCCAGTGCTTTGGG - Intronic
936708603 2:115104746-115104768 GCCTATAATCCCAGTGCTCTGGG + Intronic
937256423 2:120559187-120559209 ATCTGTAATCCCAGTGCTTTGGG - Intergenic
937716989 2:125043554-125043576 ATCTATAATCCCAGTGCTTTGGG + Intergenic
937940902 2:127285298-127285320 GTCTATAATCCCAGTACTTTGGG + Intronic
938026919 2:127957413-127957435 GCCTATAATCCCAGTGCTTTGGG + Intronic
938028177 2:127968773-127968795 CTCACTAATCCCAGCGCTTTGGG - Intronic
938318797 2:130348259-130348281 TGTAATAATCCCAGCGCTTTGGG + Intergenic
939042001 2:137200926-137200948 ACCTATAATCCCAGTGCTTTGGG - Intronic
939175349 2:138741508-138741530 TCCAAAAATCCCAGTGATTTTGG + Intronic
939264783 2:139857318-139857340 TTCTATAATCTCAGTGTTTTCGG + Intergenic
939395338 2:141622148-141622170 ATCTATAATCCCAGTACTTTGGG - Intronic
939516759 2:143178716-143178738 GCCTATAATCCCAGTGCTATGGG - Intronic
939719973 2:145636341-145636363 TTTTGTAATCCCAGTGCTCTGGG - Intergenic
940186314 2:150987869-150987891 ATAAATAATCCCAGTACTTTGGG + Intergenic
940411650 2:153371045-153371067 TTTAATAATCCCAATTGTGTTGG - Intergenic
940947097 2:159630196-159630218 ATCTGTAATCCCAGTGCTTTGGG + Intergenic
941397424 2:164990822-164990844 ATCTGTAATCCCAGTGCTTTGGG + Intergenic
942008222 2:171731491-171731513 TCCTGTAATCCCAGTGCTTTAGG + Intronic
942102215 2:172595327-172595349 GCCTATAATCCCAGTGCTTTGGG - Intronic
942243346 2:173984355-173984377 ATCTATAATCCCAGTACTTTGGG - Intergenic
942273595 2:174301454-174301476 ACCTATAATCCCAGTGCTTTGGG - Intergenic
942325192 2:174770405-174770427 GCCTATAATCCCAGTGCTTTGGG + Intergenic
942368796 2:175258429-175258451 TTCACCAAACCCAGTGCAGTAGG + Intergenic
942576184 2:177365830-177365852 GCCTATAATCCCAGTGCTTTGGG + Intronic
942699343 2:178686672-178686694 GCCTATAATCCCAGTGCTTTGGG - Intronic
942787906 2:179721026-179721048 TTCTGTAGTCCCAGTGCTTTGGG - Intronic
942874104 2:180772245-180772267 ACCTGTAATCCCAGTGCTGTGGG + Intergenic
943660255 2:190552470-190552492 TGCTGTAATCCCAGTGCTTTGGG + Intergenic
944067699 2:195636774-195636796 TTAAATAATCCCAGCACTTTGGG + Intronic
944419473 2:199514082-199514104 GTTTATAATCCCAGTGCTTTGGG - Intergenic
944503707 2:200388309-200388331 ACCTATAATCCCAGTGCTTTGGG + Intronic
944560430 2:200930579-200930601 TCCCATAATCCCAGTGCTTTGGG - Intronic
944571601 2:201050672-201050694 GTCTATAATCCCAGTACTTTGGG + Intronic
944583801 2:201156016-201156038 GGCCATAATCCCAGTGCTTTGGG - Intronic
944798285 2:203210008-203210030 GTCTGTAATCCCAGTGCTTTGGG - Intronic
944801804 2:203243947-203243969 ATCGATAATCCCAGTACTTTGGG - Intronic
945013457 2:205489350-205489372 ACCTATAATCCCAGTGCTTTAGG + Intronic
945060396 2:205903835-205903857 TGCTATAATCCCAGTACTTTGGG - Intergenic
945262604 2:207858738-207858760 ATCTATAATCCCAGTGCTTTGGG - Intronic
946263713 2:218520199-218520221 GTCTATAATCCCAGTACTTTGGG - Intronic
946345467 2:219106627-219106649 TTCAATAATCCATCTGTTGTAGG - Intronic
946350084 2:219144953-219144975 ATCTATAATCCCAGTACTTTGGG + Intronic
946390582 2:219414071-219414093 TTCCATAATCCCAGCACTTTAGG + Intergenic
946723143 2:222632687-222632709 ATCTATAATCCCAGGGCTTTGGG + Intronic
946754051 2:222925075-222925097 TCCTGTAATCCCAGTGCTTTGGG + Intronic
946910820 2:224458848-224458870 GTCTGTAATCCCAGTGCTTTGGG - Intergenic
947010850 2:225564868-225564890 TCCTATAATCCCAGCACTGTGGG + Intronic
947042984 2:225945319-225945341 GGCTATAATCCCAGTACTGTGGG + Intergenic
947207242 2:227673170-227673192 ATCTATAATCCCAGTGCTTTGGG + Intergenic
947271216 2:228337752-228337774 ACCAATAATCCCAGTACTTTGGG - Intergenic
947391579 2:229644604-229644626 TTCAAAAATCCCAGCACTTTGGG - Intronic
947507148 2:230716659-230716681 GCCTATAATCCCAGTGCTTTGGG - Intronic
947507164 2:230716740-230716762 TCCTATAATCCCAGTGCTTTGGG + Intronic
947568276 2:231209941-231209963 GCCTATAATCCCAGTGCTTTGGG - Intronic
947780957 2:232762782-232762804 GCCTATAATCCCAGTGCTTTGGG + Intronic
947945448 2:234097920-234097942 GCCTATAATCCCAGTGCTTTGGG - Intergenic
948212037 2:236201411-236201433 ATCTATAATCCCAGCGCTTTGGG - Intronic
948968846 2:241407676-241407698 TTCAATGAGCCAGGTGCTGTGGG - Intronic
1168835556 20:874977-874999 ATCTGTAATCCCAGTGCTTTGGG - Intronic
1168879563 20:1194968-1194990 TCCTGTAATCCCAGTGCTTTGGG + Intergenic
1168993362 20:2113660-2113682 TTCAATAATCCCAGTGCTGTAGG - Intronic
1169022287 20:2339375-2339397 ATCTGTAATCCCAGTGCTTTGGG + Intronic
1169241375 20:3983997-3984019 GCCAGTAATCCCAGTGCTTTGGG + Intronic
1169468190 20:5860024-5860046 TTCAACTTTCCCAGTGTTGTTGG + Intronic
1169482358 20:5996019-5996041 ATCTATAATCCCAGAGCTTTGGG + Intergenic
1169931415 20:10836992-10837014 TTCAGTACCCACAGTGCTGTGGG + Intergenic
1169977476 20:11346248-11346270 TTCATAAATCCCATTGCTGTGGG - Intergenic
1170020577 20:11832929-11832951 GCCTATAATCCCAGTGCTTTTGG - Intergenic
1170147080 20:13187488-13187510 TTCCATAATCCCAGCACTTTGGG + Intergenic
1170165044 20:13352975-13352997 ATCTGTAATCCCAGTGCTTTGGG + Intergenic
1170462892 20:16595542-16595564 GTCTGTAATCCCAGTGCTTTGGG + Intergenic
1170493839 20:16905272-16905294 TGCCGTAATCCCAGTGCTTTGGG + Intergenic
1170616949 20:17961051-17961073 TTAAAAAATCGCAGTGCTTTTGG + Intronic
1170841449 20:19927807-19927829 CCCTATAATCCCAGTGCTGTGGG - Intronic
1170867163 20:20168320-20168342 TTCTGTAATCCCAGTACTTTGGG - Intronic
1170985881 20:21257921-21257943 GTCTATAATCCCAGTACTTTGGG - Intergenic
1171139232 20:22726514-22726536 GCCTATAATCCCAGTGCTTTGGG - Intergenic
1171497711 20:25568825-25568847 CCCTATAATCCCAGTGCTTTGGG + Intronic
1172048371 20:32097915-32097937 ACCTATAATCCCAGTGCTTTAGG + Intronic
1172084148 20:32365881-32365903 TTCTATAATCCCAGCACTTTAGG + Intronic
1172369341 20:34375751-34375773 TTCTATAATCCCAGCACTTTGGG + Intronic
1172457654 20:35090631-35090653 TCCTGTAATCCCAGTGCTTTGGG - Intronic
1172495837 20:35383448-35383470 CTCAGTAATCCCAGTACTTTGGG + Intronic
1172537813 20:35687836-35687858 ATCTGTAATCCCAGTGCTTTGGG + Intronic
1172724612 20:37028402-37028424 CACAGTAATCCCAGTGCTTTGGG + Intronic
1172866447 20:38102958-38102980 ACCTATAATCCCAGTGCTTTGGG + Intronic
1173230813 20:41195373-41195395 ATCTATAATCCCAGTGCTTTGGG - Intronic
1173256703 20:41398887-41398909 GTCTGTAATCCCAGCGCTGTGGG + Intergenic
1173599186 20:44280666-44280688 ATTTATAATCCCAGTGCTTTGGG + Intronic
1173682559 20:44895725-44895747 ATCTATAATCCCAGTGCTTTTGG - Intronic
1173919984 20:46737054-46737076 ACCTATAATCCCAGTGCTTTGGG + Intergenic
1173999690 20:47365383-47365405 TCCTGTAATCCCAGTGCTTTGGG + Intergenic
1174030455 20:47620368-47620390 TCAAGTAATCCCAGTGCTTTGGG - Intronic
1174220109 20:48947442-48947464 GCCTATAATCCCAGTGCTTTGGG + Intronic
1174247740 20:49194497-49194519 GTCTATAATCCCAGCACTGTGGG + Intergenic
1174800406 20:53558509-53558531 GCCTATAATCCCAGTACTGTGGG + Intergenic
1174815300 20:53682037-53682059 GCCTATAATCCCAGTGCTTTGGG + Intergenic
1174837718 20:53873909-53873931 GCCAGTAATCCCAGCGCTGTGGG - Intergenic
1174847750 20:53959655-53959677 TTCTGTAATCCCAGTGCTTTGGG - Intronic
1175111751 20:56653332-56653354 TCCTGTAATCCCAGTGCTTTGGG - Intergenic
1175434864 20:58937840-58937862 ACCTATAATCCCAGTGCTTTGGG - Intergenic
1175741742 20:61424774-61424796 CTCAGTCATCCCTGTGCTGTGGG + Intronic
1175755950 20:61530287-61530309 ACCTATAATCCCAGTGCTTTGGG - Intronic
1176191469 20:63812515-63812537 GCCTATAATCCCAGTGCTTTGGG + Intronic
1176199173 20:63852557-63852579 TTCTATAATCCCAGCACTTTGGG + Intergenic
1176333151 21:5569164-5569186 GCCTGTAATCCCAGTGCTGTGGG + Intergenic
1176394606 21:6251788-6251810 GCCTGTAATCCCAGTGCTGTGGG - Intergenic
1176442551 21:6737316-6737338 GCCTGTAATCCCAGTGCTGTGGG + Intergenic
1176466813 21:7064386-7064408 GCCTGTAATCCCAGTGCTGTGGG + Intronic
1176490374 21:7446164-7446186 GCCTGTAATCCCAGTGCTGTGGG + Intergenic
1176510268 21:7692219-7692241 GCCTGTAATCCCAGTGCTGTGGG - Intergenic
1176581224 21:8529189-8529211 TTGAAAAATTCCATTGCTGTTGG + Intergenic
1176703314 21:10085350-10085372 GCCAATAATCCAAGTGCTTTGGG - Intergenic
1176927573 21:14768687-14768709 TACCATAATCCCAGTACTTTGGG + Intergenic
1176954984 21:15091926-15091948 GCCTATAATCCCAGTGCTTTGGG + Intergenic
1177148584 21:17432226-17432248 ACCGATAATCCCAGTGCTTTGGG + Intergenic
1177177618 21:17717065-17717087 TTAAATAATCCCAGAACTTTGGG - Intergenic
1177193493 21:17878182-17878204 TTCTGTAATCCCAGCGCTTTGGG + Intergenic
1177325593 21:19584264-19584286 GCCTATAATCCCAGTGCTTTGGG + Intergenic
1177681012 21:24371203-24371225 TCCTGTAATCCCAGTGCTTTTGG + Intergenic
1178070127 21:28955663-28955685 TTCTATAATCCCAGCACTTTGGG + Intronic
1178232364 21:30801074-30801096 GTCTATAATCCCAGTGCTTTGGG - Intergenic
1178432418 21:32528429-32528451 ATCTGTAATCCCAGTGCTTTGGG + Intergenic
1178959683 21:37053478-37053500 GTCTATAATCCCAGTGATTTGGG - Intergenic
1178996133 21:37401740-37401762 ATCTGTAATCCCAGTGCTTTGGG - Intronic
1178999474 21:37443267-37443289 ATCTGTAATCCCAGTGCTTTGGG - Intronic
1180539892 22:16434801-16434823 GTCTATAATGCCAGTGCTTTGGG - Intergenic
1180689713 22:17702891-17702913 ATCTGTAATCCCAGTGCTTTGGG + Intronic
1180889145 22:19272901-19272923 GTCTGTAATCCCAGTGCTTTGGG - Intronic
1180909115 22:19436359-19436381 GCCTATAATCCCAGTGCTTTGGG - Intronic
1180919265 22:19511587-19511609 ACCTATAATCCCAGTGCTTTGGG - Intronic
1180937229 22:19633700-19633722 GCCTATAATCCCAGTGCTTTGGG + Intergenic
1181039565 22:20185457-20185479 TCCCATAATCCCAGGGCTTTGGG - Intergenic
1181081741 22:20420067-20420089 ATCTATAATCCCAGTGCTTTGGG - Intergenic
1181089472 22:20462617-20462639 GTCAATAATCCCAGCACTTTGGG - Intronic
1181152077 22:20891703-20891725 GCCAATAATCCCAGTGCTTTGGG + Intergenic
1181152944 22:20898249-20898271 GTCTATAATCCCAGTACTTTGGG - Intergenic
1181515208 22:23406807-23406829 ATCTATAATCCCAGTACTTTGGG + Intergenic
1181788225 22:25243054-25243076 ACCCATAATCCCAGTGCTTTGGG - Intergenic
1181819963 22:25468067-25468089 ACCTATAATCCCAGTGCTTTGGG - Intergenic
1182066138 22:27433104-27433126 ATCAGTAATTCCAGTGCTTTGGG - Intergenic
1182195613 22:28513103-28513125 TTCTGTAATCCAAGTGCTTTGGG - Intronic
1182459790 22:30475491-30475513 ACCTATAATCCCAGTGCTTTGGG + Intergenic
1182462681 22:30493742-30493764 ATCTATAATCCCAGCACTGTGGG + Intronic
1182611118 22:31548308-31548330 TCCTATAATCCCAGTACTTTGGG + Intronic
1182641434 22:31771040-31771062 GCCTATAATCCCAGTGCTTTGGG - Intronic
1182817841 22:33182079-33182101 GCCTATAATCCCAGTGCTTTAGG - Intronic
1182896874 22:33866222-33866244 ACCTATAATCCCAGTGCTTTAGG - Intronic
1182953999 22:34403759-34403781 GCCCATAATCCCAGTGCTCTGGG - Intergenic
1183035795 22:35140192-35140214 ACCTATAATCCCAGTGCTTTGGG + Intergenic
1183071478 22:35399568-35399590 GCCAGTAATCCCAGTGCTTTGGG + Intergenic
1183173103 22:36202367-36202389 GCCTGTAATCCCAGTGCTGTGGG - Intronic
1183248585 22:36712284-36712306 ATCCATAATCCCAGAGCTTTGGG + Intergenic
1183994737 22:41624425-41624447 CTCTATAATCCCAGTACTTTGGG + Intronic
1184227900 22:43140748-43140770 GTCTGTAATCCCAGTGCTTTGGG - Intronic
1184633522 22:45805901-45805923 GCCGATAATCCCAGTGCTTTGGG + Intronic
1184752156 22:46492982-46493004 GTCTATAATCCCAGTGCTTTGGG + Intronic
1185295676 22:50052960-50052982 GTCAGTAATCCCAGCACTGTGGG + Intronic
1185396362 22:50592727-50592749 ACCTATAATCCCAGTGCTTTGGG + Intronic
949372808 3:3353833-3353855 ACCTATAATCTCAGTGCTGTGGG - Intergenic
949470752 3:4393590-4393612 TTCTGTAATACCAGTGCTTTGGG - Intronic
949551372 3:5114988-5115010 GTCTATAATCCCAGTACTTTGGG + Intergenic
949752810 3:7374436-7374458 ATCTGTAATCCCAGTGCTCTGGG - Intronic
949998057 3:9634422-9634444 TTCAGTAATCCCAGCACTTTGGG - Intergenic
950060010 3:10062958-10062980 ATCTGTAATCCCAGTGCTTTGGG - Intronic
950221334 3:11198610-11198632 TCCCATAATCCCAGTGCTTTGGG + Intronic
950307698 3:11929018-11929040 GTGTATAATCCCAGTGCTTTGGG - Intergenic
951438669 3:22696209-22696231 GCCTATAATCCCAGTGCTTTGGG + Intergenic
951488551 3:23242189-23242211 GCCTATAATCCCAGTGCTTTGGG - Intronic
951489304 3:23251112-23251134 CACAGTAATCCCAGTGCTTTGGG - Intronic
951517670 3:23579429-23579451 ATCTGTAATCCCAGTGCTTTGGG + Intronic
951872865 3:27384701-27384723 GTCTATAATCCCAGCACTGTGGG + Intronic
951887828 3:27541102-27541124 GCCTATAATCCCAGTGCTTTGGG + Intergenic
952119771 3:30228438-30228460 GTCTATAATCCCAGTACTGTGGG + Intergenic
952236184 3:31482404-31482426 ACCTATAATCCCAGTGCTGTGGG - Intergenic
952246435 3:31597716-31597738 GCCTATAATCCCAGTGCTTTGGG - Intronic
952255733 3:31694027-31694049 ATCCGTAATCCCAGTGCTTTTGG - Intronic
952269891 3:31820335-31820357 GCCTATAATCCCAGTGCTTTGGG + Intronic
952315374 3:32227759-32227781 GTCTGTAATCCCAGTGCTTTGGG - Intergenic
952372987 3:32740963-32740985 AACTATAATCCCAGTGCTTTGGG - Intronic
952399574 3:32951086-32951108 TCCTGTAATCCCAGTGCTTTAGG + Intergenic
952444373 3:33366405-33366427 ATCTATAACCCCAGTGCTTTGGG + Intronic
952454144 3:33457213-33457235 GCCTATAATCCCAGTGCTTTGGG + Intergenic
952874424 3:37931412-37931434 ATCTATAATCCCAGTGCTTTGGG - Intronic
952930693 3:38358601-38358623 ACCTATAATCCCAGTGCTTTGGG - Intronic
952941808 3:38451361-38451383 TTCTATAATCCCAGCACTTTGGG + Intergenic
953156598 3:40380894-40380916 GTCTGTAATCCCAGTGCTTTGGG + Intergenic
953212863 3:40891831-40891853 TTCTATAATCCCAGCACTTTGGG + Intergenic
953303318 3:41801588-41801610 TCCTGTAATCCCAGTGCTTTGGG + Intronic
953510679 3:43535221-43535243 TTCTGTAATCCCAGAGCTTTGGG - Intronic
953941628 3:47104280-47104302 GTCTGTAATCCCAGTGCTTTGGG + Intronic
953974845 3:47374716-47374738 GTCTATAATCCCAGTACTTTGGG + Intergenic
954049951 3:47966637-47966659 GCCAATAATCCCAGCGCTTTGGG - Intronic
954171952 3:48811226-48811248 GTCTGTAATCCCAGTGCTTTGGG + Intronic
954777476 3:53033046-53033068 GCCTATAATCCCAGTGCTCTGGG + Intronic
954973460 3:54671451-54671473 TTCAGTAATCACTTTGCTGTTGG + Intronic
955096722 3:55806073-55806095 TTCAATAATCCCAGCACTTTGGG + Intronic
955197209 3:56815952-56815974 GTCTATAATCCCAGTACTTTGGG + Intronic
955202506 3:56863557-56863579 ACCTATAATCCCAGTGCTTTGGG - Intronic
955263284 3:57416349-57416371 GTCTGTAATCCCAGTGCTTTGGG - Intronic
955306590 3:57839196-57839218 ACCCCTAATCCCAGTGCTGTGGG - Intronic
955366172 3:58312111-58312133 GTCTGTAATCCCAGTGCTTTGGG - Intronic
955485677 3:59432379-59432401 GTCAGTAATCCCAGTACTTTGGG - Intergenic
955685724 3:61546863-61546885 TCCTGTAATCCCAGTGCTTTGGG + Intergenic
955688492 3:61567416-61567438 TCCTATAATCACAGTGCTTTGGG + Intronic
955758425 3:62251129-62251151 TATAATAATCTCAGTGCTTTGGG + Intronic
956133492 3:66076184-66076206 ATCTATAATCCTAGTGCTTTGGG + Intergenic
956217653 3:66865738-66865760 TCCTGTAATCCCAGTGCTTTGGG - Intergenic
956293136 3:67682726-67682748 ACCTATAATCCCAGTGCTTTTGG - Intergenic
956345035 3:68269192-68269214 TCCTGTAATCCCAGTGCTTTGGG + Intronic
956924344 3:73967414-73967436 GCCTATCATCCCAGTGCTGTGGG - Intergenic
956942551 3:74180477-74180499 GACTATAATCCCAGTGCTTTGGG + Intergenic
957319295 3:78608363-78608385 AGCTATAATCCCAGTGCTTTAGG - Intronic
957470189 3:80649194-80649216 GTCTCTAATCCCAGTGCTTTGGG + Intergenic
958929497 3:100193767-100193789 GCCTATAATCCCAGTGCTTTGGG - Intronic
959071363 3:101704879-101704901 TCCTGTAATCCCAGTGCTTTGGG + Intergenic
959210341 3:103370683-103370705 TCCTGTAATCCCAGCGCTGTGGG - Intergenic
959343630 3:105163552-105163574 ACCTATAATCCCAGTGCTTTGGG + Intergenic
959450843 3:106497717-106497739 ACCTATAATCCCAGTGCTTTGGG - Intergenic
959451665 3:106511015-106511037 TTCAATAATCTCCGTGGGGTTGG + Intergenic
959474784 3:106796465-106796487 TTCAGTAATCCCAGGGGTTTGGG + Intergenic
959702490 3:109311059-109311081 ACCTATAATCCCAGTGCTTTGGG - Intronic
959706590 3:109343746-109343768 TCCTATAATCCCAGCGCTTTGGG - Intergenic
960101813 3:113750218-113750240 GTCTGTAATCCCAGTGCTTTGGG + Intronic
960144613 3:114187555-114187577 TTCAATCATGGCAGTGCAGTAGG - Intronic
960217359 3:115058130-115058152 TCCCATAATCCCCGTGTTGTGGG - Intronic
960449154 3:117784562-117784584 TCCTATAATCCAAGTGCTATGGG + Intergenic
960894616 3:122489527-122489549 ACCTATAATCCCAGTGCTTTGGG - Intronic
961170590 3:124795230-124795252 GTCTATAATCCCAGTACTTTGGG + Intronic
961266454 3:125647007-125647029 ATCTATAATCCCGGTGCTTTGGG + Intergenic
961507706 3:127381765-127381787 TTCAATATTAGCAGAGCTGTTGG + Intergenic
961560553 3:127725804-127725826 ATCTGTAATCCCAGTGCTTTGGG + Intronic
961837206 3:129672336-129672358 GTCTATATTCCCAGTGCTTTGGG + Intronic
962725603 3:138223862-138223884 ACCAGTAATCCCAGTGCTTTGGG + Intronic
962784067 3:138750136-138750158 TCCTATAATCCCAGTACTTTGGG - Intronic
962908180 3:139824301-139824323 ATCTATAATTCCAGTGCTTTGGG - Intergenic
963071140 3:141306331-141306353 GTCTATAATCCCAGCACTGTGGG - Intergenic
963160378 3:142144797-142144819 GCCTATAATCCCAGTGCTTTGGG - Intronic
963167812 3:142223577-142223599 GCCTATAATCCCAGTGCTCTGGG + Intronic
963298177 3:143570063-143570085 TTCTATAATCCCAGCACTTTGGG - Intronic
963454404 3:145524767-145524789 TTCTTTAATCCCAGCACTGTGGG - Intergenic
963804082 3:149705930-149705952 TTCTGTAATCCCAGCACTGTGGG + Intronic
963964407 3:151349541-151349563 GTCTGTAATCCCAGTGCTTTGGG - Intronic
964122028 3:153194892-153194914 TTCTATAATCCCAGCACTTTGGG - Intergenic
964437544 3:156670011-156670033 ACCTATAATCCCAGTGCTTTGGG - Intergenic
964591052 3:158362077-158362099 TCCTATAATCCCAGCACTGTAGG + Intronic
964677039 3:159295156-159295178 TTTAATAATCCCAGCACTTTGGG + Intronic
964775732 3:160274677-160274699 GTCTGTAATCCCAGTGCTTTGGG + Intronic
965176673 3:165344067-165344089 AACTATAATCCCAGTGCTTTGGG - Intergenic
965285859 3:166819711-166819733 TTCTGTAATCCCAGTACTTTGGG + Intergenic
965427171 3:168541449-168541471 GCCTATAATCCCAGTGCTTTGGG + Intergenic
965673413 3:171170789-171170811 ACCTATAATCCCAGTGCTTTGGG + Intronic
965807933 3:172561477-172561499 TTCTGTAATCCCAGAGCTGTGGG + Intergenic
966369490 3:179233116-179233138 TTCTATAATCCCAGCACTTTGGG - Intronic
966529632 3:180961089-180961111 GTCAATAATCCCAGCGCTTTGGG + Intronic
967412996 3:189185483-189185505 GTCAGTAATCCCAGTGCTTTGGG - Intronic
967492364 3:190108274-190108296 GTAAATAATCTCAGTGCTTTGGG - Intronic
967517813 3:190391044-190391066 TCCTATAATCCCAGTACTTTAGG - Intronic
967710685 3:192703962-192703984 GTCTATAATCCCAGTGCTTTGGG - Intronic
967818767 3:193820994-193821016 ACCTATAATCCCAGTGCTTTGGG - Intergenic
967925568 3:194643586-194643608 TACATTACTCCCAGTGATGTAGG - Intronic
968016459 3:195338578-195338600 TCCTGTAATCCCAGTGCTTTGGG - Intronic
968061962 3:195732617-195732639 GCCAATAATCCCAGTGCTTTGGG - Intronic
968092141 3:195905456-195905478 TCCTCTAATCCCAGTGCTTTGGG - Intronic
968347799 3:198025627-198025649 ATCTATAATCCCAGTACTTTGGG - Intronic
968667802 4:1830591-1830613 ATCTATAATCCCAGCACTGTGGG - Intronic
968851869 4:3086409-3086431 ACCTATAATCCCAGTGCTTTGGG + Intronic
969286644 4:6206552-6206574 GTCTATAATCCTAGTGCTTTGGG + Intergenic
969454473 4:7293476-7293498 TCCAATGATCCCTCTGCTGTTGG + Intronic
969546285 4:7830866-7830888 TTCTGTAATCCCAGTGCTTTGGG - Intronic
969551796 4:7873605-7873627 GTCTGTAATCCCAGTGCTTTGGG - Intronic
970450740 4:16164688-16164710 TTTAATAATCCCAGCACTTTGGG - Intronic
971157308 4:24096967-24096989 TCCTATAATCCCAGTGCTTTGGG + Intergenic
971295547 4:25386467-25386489 GTCTATAATCCCAGAGCTTTGGG - Intronic
971323508 4:25624845-25624867 TTCAACAATCACAGTGATTTGGG - Intergenic
971371987 4:26027357-26027379 GCCTATAATCCCAGTGCTTTGGG + Intergenic
971391373 4:26189090-26189112 ATCTGTAATCCCAGTGCTTTGGG + Intronic
972095440 4:35342256-35342278 TTCTAGGATTCCAGTGCTGTGGG + Intergenic
972365494 4:38370708-38370730 GCCTATAATCCCAGTGCTTTAGG - Intergenic
972414496 4:38825054-38825076 ATCTATAATCCCAGTACTGTGGG - Exonic
973239066 4:47938050-47938072 ATCTGTAATCCCAGTGCTTTGGG + Intronic
973720605 4:53719966-53719988 GCCTATAATTCCAGTGCTGTGGG - Intronic
973737592 4:53888036-53888058 GTCCATAATCCCAATGCTTTGGG + Intronic
973762086 4:54126985-54127007 ATCTGTAATCCCAGTGCTTTGGG - Intronic
973826396 4:54711138-54711160 TCCTGTAATCCCAGTGCTTTGGG - Intronic
973904932 4:55519314-55519336 ACCTACAATCCCAGTGCTGTGGG - Intronic
974064990 4:57069327-57069349 GCCTATAATCCCAGTGCTTTGGG + Intronic
974445395 4:61974226-61974248 TCCTATAATCCCAGCGCTTTGGG - Intronic
974498017 4:62658259-62658281 TCCTATAATCCCAGTACTTTGGG - Intergenic
974891640 4:67891073-67891095 TTCTATAATCCCAGCACTTTGGG - Intergenic
975038897 4:69720106-69720128 GCCTATAATCCCAGTGCTTTGGG + Intergenic
975508092 4:75161527-75161549 TCCTGTAATCCCAGTGCTTTGGG - Intergenic
975619759 4:76284496-76284518 TCCTATAATCCCAGTGCTTTGGG + Intronic
975860915 4:78675892-78675914 TCCTATAATCCCAGTACTTTGGG + Intergenic
976151917 4:82100982-82101004 ATCTGTAATCCCAGTGCTTTGGG + Intergenic
976271990 4:83239700-83239722 TCCTATAATCCCAGTGTTTTGGG + Intergenic
976294318 4:83454684-83454706 GCCTATAATCCCAGTGCTTTAGG - Intronic
976729433 4:88246970-88246992 AGCAGTAATCCCAGTGCTTTGGG - Intergenic
977220255 4:94329817-94329839 AATAATAATCCCAGTGTTGTTGG + Intronic
977411788 4:96675200-96675222 ATCAGTAATCCCAGTGCTTTGGG - Intergenic
977621244 4:99140312-99140334 ATCTGTAATCCCAGTGCTTTGGG + Intronic
977700695 4:100019529-100019551 ATCTATAATCCCAGCGCTATGGG - Intergenic
977925100 4:102691765-102691787 GCCTATAATCCCAGTGCTTTGGG - Intronic
978020617 4:103806636-103806658 GTCATTAATCCCAGTGCTTTGGG - Intergenic
978488131 4:109279348-109279370 GCCAGTAATCCCAGTGCTTTGGG + Intronic
978655250 4:111058484-111058506 GTCTGTAATCCCAGTGCTCTGGG - Intergenic
978967623 4:114760942-114760964 TTTAATAATCCCAGTTCTCCTGG - Intergenic
979001809 4:115230638-115230660 TGCTATAATCCCAGAGCTTTGGG + Intergenic
979143747 4:117213994-117214016 GTCTATAATCCCAGTGATTTGGG + Intergenic
979210554 4:118096181-118096203 TTTAAGAATCAGAGTGCTGTGGG - Intronic
979361856 4:119774601-119774623 CCCAATAATACCAGTGCTGCTGG - Intergenic
979541432 4:121888117-121888139 TTCTACAATTCCAGTGCTTTGGG - Intronic
979567329 4:122169212-122169234 ACCTATAATCCCAGTGCTTTGGG - Intronic
979577542 4:122312293-122312315 ACCTATAATCCCAGTGCTTTGGG - Intronic
979613826 4:122719076-122719098 GCCTATAATCCCAGTGCTTTGGG - Intergenic
980047571 4:128005703-128005725 GTCTATAATCCTAGTGCTTTGGG - Intronic
980773755 4:137413179-137413201 TCCTATAATCCCAGTACTTTGGG - Intergenic
980907928 4:138966439-138966461 TTCTGTAATCCCAGTACTTTGGG - Intergenic
981086323 4:140688404-140688426 TCCTCTAATCCCAGTGCTTTCGG + Intronic
981707731 4:147679170-147679192 GTCTGTAATCCCAGTGCTTTGGG + Intronic
981841978 4:149123529-149123551 GCCTATAATCCCAGTGCTTTGGG + Intergenic
981930791 4:150187288-150187310 GTCTTTAATCCCAGTGCTTTGGG - Intronic
981950248 4:150397535-150397557 ATCTATAATCCCAGTGCTTTGGG - Intronic
981953302 4:150438221-150438243 ACCTATAATCCCAGTGCTCTGGG + Intronic
981984132 4:150833033-150833055 ACCTATAATCCCAGTGCTTTGGG - Intronic
981999126 4:151005853-151005875 GTCTGTAATCCCAGTGCTTTGGG - Intronic
982228709 4:153188667-153188689 GCCTATAATCCCAGTGCTTTGGG + Intronic
982325584 4:154125728-154125750 TGCAAGGATTCCAGTGCTGTAGG + Intergenic
982350646 4:154411337-154411359 TCCTATAATCCCAGTACTTTGGG + Intronic
982363034 4:154543406-154543428 GCCTATAATCCCAGTGCTTTGGG - Intronic
982366044 4:154580071-154580093 AACTATAATCCCAGTGCTTTGGG + Intergenic
982367786 4:154598986-154599008 GTCTGTAATCCCAGTGCTTTGGG - Intergenic
982462862 4:155692797-155692819 GTCTGTAATCCCAGTGCTTTGGG + Intronic
982945786 4:161620393-161620415 ATCTGTAATCCCAGTGCTTTGGG + Intronic
983011643 4:162554787-162554809 ACCAGTAATCCCAGTGCTTTGGG - Intergenic
983223210 4:165062622-165062644 TGCTGTAATCCCAGTGCTTTGGG - Intergenic
983261931 4:165467061-165467083 ATCTATAATCCCAGTGCTTTGGG + Intronic
983374932 4:166914509-166914531 GCCTGTAATCCCAGTGCTGTGGG + Intronic
983575497 4:169256860-169256882 ATCTGTAATCCCAGTGCTTTGGG - Intronic
983671757 4:170246138-170246160 GCCTGTAATCCCAGTGCTGTGGG - Intergenic
984378412 4:178961055-178961077 GCCTATAATCCCAGTGCTTTGGG + Intergenic
984555885 4:181213400-181213422 ACCTATAATCCCAGTGCTTTGGG - Intergenic
984706387 4:182850169-182850191 TGGTATAATCCCAGTGCTTTGGG - Intergenic
984750971 4:183273784-183273806 TTCAAAAATCCTTGTGCTTTTGG + Intronic
984788744 4:183593895-183593917 GTCTGTAATCCCAGTGCTTTGGG - Intergenic
985044179 4:185923561-185923583 TTCACAAATCCCAGAGCTTTGGG - Intronic
985092503 4:186378500-186378522 TCCTGTAATCCCAGTGCTTTGGG - Intergenic
985100794 4:186456776-186456798 GTCTGTAATCCCAGTGCTTTAGG + Intronic
985213336 4:187619479-187619501 GCCTATAATCCCAGTGCTTTGGG + Intergenic
985495565 5:202971-202993 ACCTGTAATCCCAGTGCTGTGGG + Exonic
985504138 5:269030-269052 GTCTATAATCCCAGTACTTTGGG - Intergenic
986548433 5:8924985-8925007 TGCAATAGTCCCAGTGGTGGTGG + Intergenic
986841257 5:11700126-11700148 ATCTGTAATCCCAGTGCTTTGGG + Intronic
987360374 5:17100852-17100874 GTCTATAATCCCAGCGCTTTGGG - Intronic
987715239 5:21560320-21560342 GTCTATAATCCCAGTACTTTGGG + Intergenic
987733137 5:21802849-21802871 TTCTGTAATCCCAGTCCTTTGGG - Intronic
987854235 5:23397720-23397742 TTCTGTAATCCCAGTACTTTGGG - Intergenic
988243024 5:28638326-28638348 ACCTATAATCCCAGTGCTTTGGG + Intergenic
988445517 5:31282047-31282069 TTCAAGAATCCCAGTGGAGGAGG - Intronic
989062182 5:37420101-37420123 ATCTCTAATCCCAGTGCTTTGGG + Intronic
989630739 5:43480580-43480602 TCCTGTAATCCCAGTGCTTTGGG - Intronic
989952210 5:50312695-50312717 GTAAATAGTCCCAGTGCTTTGGG - Intergenic
990039487 5:51362034-51362056 TCCTGTAATCCCAGTGCTTTGGG + Intergenic
990301504 5:54453662-54453684 ATCTATAATCCCAATGCTTTGGG + Intergenic
990386342 5:55266872-55266894 TCCTGTAATCCCAGTGCTTTGGG - Intronic
990587302 5:57224672-57224694 GCCTATAATCCCAGTGCTTTGGG - Intronic
990593772 5:57293148-57293170 GTCTGTAATCCCAGTGCTTTGGG + Intergenic
990788368 5:59448892-59448914 TCCTGTAATCCCAGTGCTTTGGG - Intronic
990886541 5:60600902-60600924 TCCCATAATCCCCTTGCTGTGGG + Intronic
990979059 5:61585374-61585396 GCCTATAATCCCAGTGCTTTGGG - Intergenic
991043982 5:62203900-62203922 TACTATAATCCCAGTACTTTGGG - Intergenic
991075467 5:62531585-62531607 TCTAATAATCCCAGCGCTTTGGG - Intronic
991279320 5:64893885-64893907 TGCAATAATCACAGTCCTGAAGG + Intronic
991343728 5:65640276-65640298 GCCTATAATCCCAGTGCTTTGGG + Intronic
991344676 5:65651159-65651181 ACCTATAATCCCAGTGCTTTGGG + Intronic
991626516 5:68607356-68607378 GTCTACAATCCCAGTGCTTTGGG - Intergenic
991645537 5:68796968-68796990 ACCTATAATCCCAGTGCTTTGGG + Intergenic
991698659 5:69297298-69297320 ATCTATAATCCCAGCGCTTTGGG - Intronic
991907781 5:71529430-71529452 GTCTGTAATCCCAGTGCTTTGGG + Intronic
992015285 5:72568950-72568972 TGCAATAAACCTAGTGCTCTTGG + Intergenic
992129900 5:73681838-73681860 TTCTGTAATCCCAGCACTGTGGG + Intronic
992332588 5:75732246-75732268 ACCTATAATCCCAGTGCTTTGGG - Intergenic
992706125 5:79394827-79394849 GCCTATAATCCCAGTGCTTTGGG - Intronic
992861323 5:80913461-80913483 TCCTGTAATCCCAGTGCTTTGGG + Intergenic
993369526 5:87075040-87075062 ACCTATAATCCCAGTGCTTTGGG - Intergenic
993428371 5:87799174-87799196 TCCTATAATCCCAGTACTTTGGG + Intergenic
993708017 5:91193740-91193762 ATCTGTAATCCCAGTGCTTTGGG + Intergenic
993992002 5:94668737-94668759 TCCTGTAATCCCAGTGCTTTGGG - Intronic
994220850 5:97193189-97193211 GTAAATAAACTCAGTGCTGTTGG - Intergenic
994276558 5:97845080-97845102 CTGAATAATCCCTGTGCAGTGGG + Intergenic
994415126 5:99459859-99459881 TTCTGTAATCCCAGTCCTTTGGG - Intergenic
994730328 5:103483690-103483712 ATCTATAATCCCAGCACTGTGGG - Intergenic
994835255 5:104843761-104843783 ACCAGTAATCCCAGTGCTTTGGG - Intergenic
994910088 5:105893500-105893522 TTCAGTTTTCCCAGTGCTCTCGG + Intergenic
995194819 5:109354853-109354875 GTCTATAATCCCAGTGCCATGGG + Intronic
995489944 5:112680117-112680139 ATCTGTAATCCCAGTGCTTTGGG - Intergenic
996261838 5:121481018-121481040 TCCTATAATCCCAGTGTTTTAGG + Intergenic
996537958 5:124598028-124598050 TTCAATAAAAACTGTGCTGTTGG + Intergenic
997019889 5:129986900-129986922 TCCTATAATCCCAGTACTTTGGG - Intronic
997176145 5:131779938-131779960 GTCTATAATCCCAGTACTTTGGG + Intronic
997192970 5:131956546-131956568 TTAAATAGTCCAAGGGCTGTAGG - Intronic
997321413 5:132982023-132982045 TTCTATAATCCCAGCACTTTGGG - Intergenic
997924499 5:138016345-138016367 TCCTATAATCCCAGTGCTTTGGG + Intronic
998070317 5:139192736-139192758 CTTAATAATCCCAGTACTTTGGG + Intronic
998076798 5:139243186-139243208 TCCTGTAATCCCAGTGCTTTGGG + Intronic
998422460 5:142000190-142000212 GCCTATAATCCCAGTGCTTTGGG - Intronic
998466334 5:142347506-142347528 TGTAATAATCCCAGTACTTTGGG + Intergenic
998653244 5:144144749-144144771 TTAACTTATCCCAGTGCTCTGGG - Intergenic
998775830 5:145600890-145600912 TCCTTTAATCCCAGTGCTTTGGG + Intronic
998963542 5:147512656-147512678 TTCTGTAATCCCAGTACTTTGGG - Intergenic
999315506 5:150580935-150580957 GCCTATAATCCCAGTGCTTTGGG + Intergenic
999409477 5:151338415-151338437 TGCTATAATCCCAGTACTTTGGG + Intronic
999416159 5:151397855-151397877 GTCTATAATCTCAGTGCTTTGGG + Intergenic
999466269 5:151808915-151808937 GCCTGTAATCCCAGTGCTGTGGG + Exonic
999873004 5:155771809-155771831 GGCCATAATCCCAGTGCTTTGGG - Intergenic
999993383 5:157068868-157068890 GCCTATAATCCCAGTGCTCTGGG - Intergenic
1000094399 5:157958430-157958452 TTCTATAATCCCAGCACTTTGGG - Intergenic
1000344030 5:160299409-160299431 TTCTATAATCCCAGCACTTTGGG - Intronic
1000359963 5:160437832-160437854 ATCTATAATCCCAGTGCTTTGGG + Intergenic
1000438044 5:161237666-161237688 ATCTGTAATCCCAGTGCTTTAGG + Intergenic
1000514748 5:162226263-162226285 TTCAGTAATCCCAGCACTTTGGG - Intergenic
1000620435 5:163479409-163479431 ACCAGTAATCCCAGTGCTTTGGG + Intronic
1000681158 5:164186695-164186717 GTCTATAATCTCAGTGCTTTGGG + Intergenic
1001005163 5:168043346-168043368 GCCTATAATCCCAGTGCTTTGGG - Intronic
1001066630 5:168539963-168539985 GCCTATAATCCCAGTGCTTTGGG - Intergenic
1001172228 5:169430484-169430506 ACCTATAATCCCAGTGCTTTGGG + Intergenic
1001488250 5:172135777-172135799 GCCTATAATCCCAGTGCTTTGGG + Intronic
1001608073 5:172977964-172977986 GCCTATAATCCCAGTGCTTTGGG - Intergenic
1001625703 5:173131093-173131115 GCCTATAATCCCAGTGCTTTGGG - Intronic
1001673522 5:173493554-173493576 ATCTGTAATCCCAGTGCTTTGGG + Intergenic
1001718631 5:173838065-173838087 ATCTGTAATCCCAGTGCTTTGGG + Intergenic
1001739565 5:174040861-174040883 GCCTATAATCCCAGTGCTTTGGG + Intergenic
1001930103 5:175666687-175666709 GTCTGTAATCCCAGTGCTTTGGG - Intronic
1002124041 5:177028300-177028322 ATCTGTAATCCCAGTGCTTTGGG - Intronic
1002192513 5:177485723-177485745 GTCTGTAATCCCAGTGCTTTGGG + Intronic
1003037057 6:2651200-2651222 GTCTGTAATCCCAGTGCTTTGGG + Intergenic
1003078354 6:3001348-3001370 TTCATTAATCCCAGCACTCTGGG - Intronic
1003110869 6:3251226-3251248 ATCTGTAATCCCAGTGCTTTGGG - Intronic
1003601339 6:7520255-7520277 TTCTATAATCCCAGCACTTTGGG - Intergenic
1003941784 6:11035544-11035566 TTTATTAATCCCAGTGATGTTGG + Intronic
1004029038 6:11847913-11847935 TCAAATATTCCCAGAGCTGTGGG + Intergenic
1004130779 6:12917491-12917513 ACCTATAATCCCAGTGCTTTGGG + Intronic
1004134695 6:12955448-12955470 TCCTGTAATCCCAGTGCTTTGGG - Intronic
1004359588 6:14959318-14959340 GTCTGTAATCCCAGTGCTTTGGG - Intergenic
1004420494 6:15465192-15465214 TCCTGTAATCCCAGTGCTATGGG + Intronic
1004478491 6:15996880-15996902 GTCTATAATCCCAGTACTTTGGG - Intergenic
1004928298 6:20436858-20436880 ACCTGTAATCCCAGTGCTGTGGG + Intronic
1004928988 6:20443478-20443500 ACCCATAATCCCAGTGCTTTGGG + Intronic
1004935960 6:20508804-20508826 GCCTATAATCCCAGTGCTTTGGG + Intergenic
1004942839 6:20579236-20579258 ATCTGTAATCCCAGTGCTTTGGG - Intronic
1005012605 6:21350071-21350093 ACCTATAATCCCAGTGCTTTGGG - Intergenic
1005024662 6:21450884-21450906 ATCTATAATCCCAGGGCTTTGGG - Intergenic
1005070207 6:21855313-21855335 ACCAATAATTCCAGTGCTTTGGG + Intergenic
1005161117 6:22864996-22865018 TCCTATAATCCTAGTGCTTTGGG - Intergenic
1005298394 6:24448318-24448340 GTCTATAATCCCAGTGCTTTGGG + Intronic
1005302600 6:24485276-24485298 GCCTATAATCCCAGTGCTTTGGG + Intronic
1005324370 6:24684751-24684773 GCCTATAATCCCAGTGCTTTGGG + Intronic
1005398978 6:25412320-25412342 GCCAATAATCCCAGTCCTTTGGG + Intronic
1006090566 6:31626291-31626313 ATCTGTAATCCCAGTGCTTTGGG + Intronic
1006123673 6:31823240-31823262 GTCGGTAATCCCAGTGCTTTAGG - Intergenic
1006130824 6:31868514-31868536 TCCTATAATCCCAGTACTTTGGG + Intronic
1006249103 6:32765547-32765569 ACCTATAATCCCAGTGCTTTGGG - Intergenic
1006263937 6:32900683-32900705 CCCTATAATCCCAGTGCTTTGGG + Intergenic
1006491773 6:34393665-34393687 ACCAGTAATCCCAGTGCTTTGGG - Intronic
1006522844 6:34581935-34581957 GTCTGTAATCCCAGTGCTTTGGG + Intergenic
1006553945 6:34849879-34849901 TTTAATAATCCCAGCACTTTGGG + Intronic
1006648172 6:35529543-35529565 TTCTATAATCCCAGCACTTTGGG + Intergenic
1007608651 6:43134385-43134407 ACCTATAATCCCAGTGCTTTGGG + Intronic
1008019740 6:46562506-46562528 GCCTATAATCCCAGTGCTTTGGG + Intronic
1008218169 6:48821241-48821263 ATCTATAATCCCAGGGCTTTGGG + Intergenic
1008474946 6:51926530-51926552 TTCAATAATCCAAGTACAGCAGG - Intronic
1008499416 6:52165801-52165823 GCCTATAATCCCAGTGCTTTGGG - Intergenic
1008772599 6:54997205-54997227 TTCCAAAATTACAGTGCTGTGGG + Intergenic
1008864307 6:56191325-56191347 GCCAATAATCCCAGCGCTTTGGG + Intronic
1008955560 6:57212620-57212642 ACCTATAATCCCAGTGCTTTGGG + Intronic
1008987192 6:57558866-57558888 ACCTATAATCTCAGTGCTGTGGG + Intronic
1009001480 6:57721725-57721747 GTCTATAATCCCAGTACTTTGGG - Intergenic
1009394922 6:63188326-63188348 TTCAATCAACACAGTCCTGTTGG - Intergenic
1010244101 6:73646933-73646955 GTCTATAATTCCAGTGCTTTGGG - Intronic
1010848525 6:80743349-80743371 TTCTGTAATCCCAGCACTGTGGG + Intergenic
1011185129 6:84666240-84666262 TTCATTAATCCCAGTTTTATAGG + Intergenic
1011460504 6:87598280-87598302 GTCTATAATCCCAGCGCTTTGGG - Intronic
1011637861 6:89391123-89391145 GTCTATAATCCCAGTACTTTGGG + Intronic
1011646689 6:89465599-89465621 ACCCATAATCCCAGTGCTTTGGG + Intronic
1012095759 6:94957196-94957218 TCCTATAATCCCAGTGCTTTGGG - Intergenic
1012130408 6:95484106-95484128 ACCTATAATCCCAGTGCTTTGGG + Intergenic
1012130495 6:95485323-95485345 TTCTGTAATCCCAGTGCTTTGGG + Intergenic
1012140885 6:95625259-95625281 TTCTATAATCCCAGTACTTTGGG - Intergenic
1012437226 6:99227127-99227149 TCCTATAATCCCAGTGCTTTGGG - Intergenic
1012463656 6:99492749-99492771 TCCTATAATCCCAGTGCTTTGGG - Intronic
1012620805 6:101341066-101341088 ACCTATAATCCCAGTGCTTTGGG - Intergenic
1013001812 6:106030430-106030452 TGCTATAATCCCAGTGCTTTGGG - Intergenic
1013121775 6:107147667-107147689 GGCTATAATCCCAGTGCTTTGGG + Intergenic
1013141008 6:107334895-107334917 GTCTGTAATCCCAGTGCTTTGGG + Intronic
1013204050 6:107930733-107930755 CTCTATAATCCCAGTACTTTGGG + Intronic
1013270794 6:108543859-108543881 ATCATTAATCCCTTTGCTGTGGG - Intergenic
1013472526 6:110477423-110477445 GCCTATAATCCCAGTGCTTTGGG + Intergenic
1014104093 6:117543617-117543639 GCCTATAATCCCAGTGCTTTGGG - Intronic
1014149614 6:118038879-118038901 TACTATAATCCCAGTGATTTGGG - Intronic
1014453403 6:121608945-121608967 ACCAATAATCCCAGCGCTTTGGG - Intergenic
1014630718 6:123786478-123786500 TCCTATAATCCCAGTACTTTGGG + Intergenic
1014704086 6:124725361-124725383 ATCTATAATCTCAGTGCTTTGGG - Intronic
1015240764 6:131021055-131021077 GCCTGTAATCCCAGTGCTGTGGG - Intronic
1015298047 6:131621059-131621081 GTCTGTAATCCCAGTGCTTTGGG - Intronic
1015407215 6:132851556-132851578 GTCTACAATCCCAGTGCTTTTGG + Intergenic
1015539768 6:134301854-134301876 GCCAATAATCCCAGTGCTTTGGG - Intronic
1015728333 6:136322734-136322756 TGCTATAATCCCAGTGCTTTAGG + Intergenic
1016376401 6:143425253-143425275 GTCTATAATCCCAGTGCTTTGGG + Intronic
1017315374 6:153025048-153025070 GCCTATAATCCCAGTGCTTTGGG + Intronic
1017468967 6:154720937-154720959 ACCCATAATCCCAGTGCTCTGGG - Intergenic
1017504511 6:155055700-155055722 GTCTGTAATCCCAGTGCTTTGGG + Intronic
1017723752 6:157262514-157262536 TGCCATAATCCCAGCGCTATGGG + Intergenic
1017840577 6:158219126-158219148 TAAAATAATCCCAGTGAAGTGGG - Intergenic
1017910194 6:158785784-158785806 GCCTATAATCCCAGTGCTTTGGG + Intronic
1018098157 6:160411476-160411498 TCCTATAATCCCAGTGCTTTGGG + Intronic
1018221611 6:161586275-161586297 ACCTGTAATCCCAGTGCTGTGGG - Intronic
1018253115 6:161892172-161892194 GCCTATAATCCCAGTGCTTTGGG + Intronic
1019012611 6:168854017-168854039 TTCTATAATCCCAGCACTTTGGG - Intergenic
1019461662 7:1162275-1162297 TTCTGTAATCCCAGCGCTTTGGG - Intergenic
1019582929 7:1777062-1777084 GTCTGTAATCCCAGTGCTTTGGG - Intergenic
1019816948 7:3208283-3208305 TCCAGTAATCCCAGTACTTTGGG + Intergenic
1020227878 7:6294417-6294439 TTCTGTAATCCCAGTACTTTGGG - Intergenic
1020266629 7:6564902-6564924 TCCTATAATCCCAGCACTGTGGG - Intergenic
1021187668 7:17584260-17584282 ATCATTAATCCCAGTGGTGAAGG + Intergenic
1021922746 7:25502971-25502993 ATCTGTAATCCCAGTGCTCTGGG - Intergenic
1022213652 7:28236639-28236661 ATCTATAATCCCAGCACTGTGGG - Intergenic
1022673565 7:32478077-32478099 GCCTATAATCCCAGTGCTTTGGG + Intergenic
1023045154 7:36204293-36204315 AACTATAATCCCAGTGCTTTGGG - Intronic
1023175403 7:37431075-37431097 TCCAGTAATTCCAGTGCTTTGGG + Intronic
1023320879 7:38996298-38996320 ATCTATAATCCCAGCACTGTGGG - Intronic
1023815854 7:43949484-43949506 GCCTATAATCCCAGTGCTTTGGG - Intronic
1023818468 7:43967402-43967424 TCCAGTAATCCCAGTGCTTTGGG - Intergenic
1023935220 7:44734875-44734897 ACATATAATCCCAGTGCTGTAGG - Intergenic
1023978934 7:45054671-45054693 TTCACTAATCCCAGAACTGATGG + Intronic
1024193204 7:47033531-47033553 GTCTGTAATCCCAGTGCTTTGGG - Intergenic
1024827365 7:53407075-53407097 ATCTGTAATCCCAGTGCTTTGGG - Intergenic
1025005715 7:55353133-55353155 GCCCATAATCCCAGTGCTTTGGG + Intergenic
1025103980 7:56155884-56155906 GCTAATAATCCCAGTGCTTTGGG - Intergenic
1025105208 7:56165261-56165283 GCCCATAATCCCAGTGCTTTTGG + Intergenic
1025126755 7:56350775-56350797 GCCAGTAATCCCAGTGCTTTGGG + Intergenic
1025857814 7:65298736-65298758 TTCTATAATCCCAGCACTTTGGG + Intergenic
1025913464 7:65846712-65846734 GCCTATAATCCCAGTGCTTTAGG - Intergenic
1026083522 7:67242972-67242994 ACCTATAATCCCAGTGCTTTGGG - Intergenic
1026094984 7:67339869-67339891 TGTAATAATCCCAGTGCTTTGGG - Intergenic
1026095647 7:67344364-67344386 ATCTGTAATCCCAGTGCTTTGGG - Intergenic
1026101143 7:67385509-67385531 GCCTATAATTCCAGTGCTGTGGG - Intergenic
1026214028 7:68332424-68332446 ATCTATAATCACAGTGCTTTGGG - Intergenic
1026244417 7:68606133-68606155 ATCTATAATCCCAGAGCTTTGGG - Intergenic
1026279025 7:68905228-68905250 GTCTATAATCCCAGAGCTTTGGG - Intergenic
1026282283 7:68932623-68932645 GTCTGTAATCCCAGTGCTTTGGG + Intergenic
1026398550 7:69985104-69985126 TCCTGTAATCCCAGCGCTGTGGG + Intronic
1026423849 7:70269912-70269934 TCCTATAATTCCAGTGCTTTGGG + Intronic
1026505641 7:70980325-70980347 GCCTATAATCCCAGTGCTTTGGG - Intergenic
1026545738 7:71320508-71320530 ATCTGTAATCCCAGTGCTTTGGG - Intronic
1026608756 7:71838638-71838660 TCCCATAATCCCTGTGTTGTGGG + Intronic
1026612361 7:71871485-71871507 TCCTGTAATCCCAGTGCTTTGGG + Intronic
1026626467 7:71996965-71996987 ATCTATAATCCCAGTACTTTGGG + Intronic
1026703570 7:72669833-72669855 ATCTATAATCCCAGTGCCTTGGG + Intronic
1026776321 7:73233278-73233300 TCCTGTAATCCCAGTGCTTTGGG - Intergenic
1026859658 7:73777600-73777622 ACCTATAATCCCAGTGCTTTGGG - Intergenic
1026922790 7:74168750-74168772 TGCTGTAATCCCAGTGCTTTGGG - Intergenic
1027004976 7:74685234-74685256 TCCAGTAATCCCAGTACTTTGGG + Intronic
1027017173 7:74786647-74786669 TCCTGTAATCCCAGTGCTTTGGG - Intronic
1027070850 7:75159285-75159307 TCCTGTAATCCCAGTGCTTTGGG + Intergenic
1027156782 7:75773968-75773990 CCCTATAATCCCAGTGCTTTGGG - Intronic
1027168016 7:75849514-75849536 TTCTATAATCTCGGTGCTTTAGG + Intronic
1027170588 7:75869256-75869278 GTCTGTAATCCCAGTGCTTTAGG - Intronic
1027222961 7:76225620-76225642 TCCTGTAATCCCAGTGCTCTGGG + Intronic
1027257898 7:76442978-76443000 GTCTATAATCCCAGTGCTTTTGG - Intergenic
1027280950 7:76609053-76609075 GTCTATAATCCCAGTGCTTTTGG + Intergenic
1027714763 7:81656123-81656145 TTCGATAATCCCAGTAATTTAGG + Intergenic
1027850732 7:83448385-83448407 GTCTATAAGCCCAGTGCTTTGGG + Intronic
1027874764 7:83754918-83754940 GTCTATAATCCCAGTACTTTGGG + Intergenic
1028132067 7:87187272-87187294 GCCTATAATCCCAGTACTGTGGG + Intronic
1028359392 7:89949507-89949529 ACCTATAATCCCAGTGCTTTGGG - Intergenic
1028613687 7:92740015-92740037 ACCTGTAATCCCAGTGCTGTGGG - Intronic
1028830611 7:95323313-95323335 TTTATTAATCACAGTGCTGGTGG - Intronic
1028840997 7:95430203-95430225 ACCCATAATCCCAGTGCTTTGGG + Intronic
1029158326 7:98533158-98533180 GCCTATAATCCCAGCGCTGTGGG + Intergenic
1029172003 7:98637173-98637195 ATCTATAATCCTAGTGCTTTGGG + Intergenic
1029196201 7:98807190-98807212 TCCTGTAATCCCAGTGCTTTGGG - Intergenic
1029199219 7:98827404-98827426 GCCTATAATCCCAGTGCTTTGGG + Intergenic
1029213652 7:98929345-98929367 TTAAATAAGCCCAGTACTTTGGG - Intronic
1029278395 7:99421178-99421200 TCCTATAATCCCAGTGCTTTGGG + Intronic
1029281106 7:99436200-99436222 TGCTGTAATCCCAGTGCTTTGGG - Intronic
1029446215 7:100614202-100614224 GCCTATAATCCCAGTGCTTTGGG + Intronic
1029446261 7:100614507-100614529 ACCTATAATCCCAGTGCTTTGGG + Intronic
1029480241 7:100807886-100807908 ATCTGTAATCCCAGTGCTTTGGG - Intronic
1029507940 7:100973793-100973815 GCCTATAATCCCAGTGCTTTGGG + Intronic
1029563358 7:101318875-101318897 TCCTCTAATCCCAGTGCTCTGGG - Intronic
1029641924 7:101826459-101826481 CTCTATAATCCCAGTACTTTAGG - Intronic
1029723789 7:102388706-102388728 GCCTATAATCCCAGTGCTTTGGG + Intronic
1029743515 7:102504365-102504387 TCCAGTAATCCCAATGCTTTGGG - Intronic
1029761503 7:102603524-102603546 TCCAGTAATCCCAATGCTTTGGG - Intronic
1030066743 7:105665394-105665416 TTCAGGAATGCCAGTGCTGTAGG - Intronic
1030239327 7:107303698-107303720 TCCTGTAATCCCAGTGCTTTGGG - Intronic
1030271343 7:107671418-107671440 ACCTATAATCCCAGTGCTTTGGG - Intronic
1030307736 7:108036115-108036137 GACTATAATCCCAGTGCTTTGGG - Intronic
1030521970 7:110608563-110608585 GTCTATAATCCCAGGGCTTTGGG + Intergenic
1030654607 7:112152743-112152765 GCCTATAATCCCAGTGCTTTGGG - Intronic
1030743746 7:113140267-113140289 TCCAATTATCCCTGTTCTGTGGG - Intergenic
1030854888 7:114543039-114543061 TGCTATAATCCCAGCGCTTTTGG - Intronic
1031080727 7:117254771-117254793 TTCTATAATCCCAGCACTTTGGG + Intergenic
1031094982 7:117406492-117406514 TTCTATAATCCCAGCACTTTGGG + Intronic
1031415455 7:121490905-121490927 ATCAGTAATCCCAGCGCTTTGGG + Intergenic
1031466425 7:122117913-122117935 ACCTATAATCCCAGTGCTTTGGG - Intronic
1031562080 7:123250782-123250804 ATCTGTAATCCCAGTGCTTTGGG + Intergenic
1031940634 7:127785166-127785188 TCCTATAATCCCAGCACTGTGGG - Intronic
1032103483 7:129003408-129003430 ATCTGTAATCCCAGTGCTTTGGG + Intronic
1032199499 7:129809390-129809412 GCCTATAATCCCAGTGCTTTGGG + Intergenic
1032229807 7:130064720-130064742 GTCTATAATCCCAGTCCTTTGGG - Intergenic
1032261759 7:130343621-130343643 ATCTGTAATCCCAGTGCTTTGGG - Intergenic
1032485454 7:132283913-132283935 GCCTGTAATCCCAGTGCTGTGGG + Intronic
1032575612 7:133050753-133050775 TTTAGTAATCCCAGTACTTTGGG + Intronic
1033128153 7:138722797-138722819 GCCTATAATCCCAGTGCTGTGGG + Intronic
1033171708 7:139090347-139090369 ATCTGTAATCCCAGTGCTTTGGG - Intronic
1033243008 7:139696311-139696333 ATCTATAATCCCAGCGCTTTGGG + Intronic
1033399596 7:141009389-141009411 GCCTATAATCCCAGTGCTTTGGG - Intronic
1033431050 7:141289873-141289895 GCCTATAATCCCAGTGCTTTGGG + Intronic
1033777264 7:144626332-144626354 ATCTATAATCCCAGCACTGTGGG - Intronic
1034083787 7:148304954-148304976 TCCTATAATCCCAGTGCTTTGGG + Intronic
1034287933 7:149902494-149902516 TCCTGTAATCCCAGTGCTCTGGG + Intergenic
1034330607 7:150279043-150279065 GCCTATAATCCCAGTGCTTTGGG + Intronic
1034523844 7:151641768-151641790 GCCTATAATCCCAGTGCTTTGGG - Intronic
1034663193 7:152790440-152790462 TCCTGTAATCCCAGTGCTCTGGG - Intronic
1034667435 7:152830806-152830828 GCCTATAATCCCAGTGCTTTGGG - Intronic
1034951943 7:155304221-155304243 GCCTATAATCCCAGTGCTTTGGG - Intronic
1035140655 7:156757073-156757095 TTCTATAATCCCAGCACTTTGGG - Intronic
1035256636 7:157633400-157633422 GCCTATAATCCCAGTACTGTGGG - Intronic
1035405928 7:158597170-158597192 TTCTATAATCCCAGCACTTTGGG - Intergenic
1035422057 7:158738005-158738027 GTCTATAATCCCAGTGCTTTGGG + Intronic
1035674305 8:1444208-1444230 GCCTATAATCCCAGAGCTGTGGG - Intergenic
1035740106 8:1921043-1921065 TCCTGTAATCCCAGTGCTTTGGG - Intronic
1036007102 8:4678149-4678171 TTCTGTAATCCCAGTGCTTTAGG + Intronic
1036191955 8:6678673-6678695 GCCTATAATCCCAGTGCTGTGGG + Intergenic
1036555263 8:9854150-9854172 GCCCATAATCCCAGTGCTTTAGG + Intergenic
1036698537 8:10995253-10995275 ACCTATAATCCCAGTGCTTTAGG + Intronic
1036927131 8:12918091-12918113 ACCTATAATCCCAGTGCTTTGGG - Intergenic
1037118586 8:15255942-15255964 GCCCATAATCCCAGTGCTTTGGG + Intergenic
1037355104 8:18010510-18010532 GTCTATAATCCCAGTACTTTGGG + Intronic
1037505338 8:19524032-19524054 ACCTGTAATCCCAGTGCTGTGGG + Intronic
1037528799 8:19754285-19754307 ATCTATAATCCCAGCGCTTTGGG - Intronic
1037535907 8:19824230-19824252 ATCTGTAATCCCAGTGCTTTGGG + Intronic
1037574422 8:20187730-20187752 ATCTATAATCCCAGTGCTTTGGG + Intergenic
1037771590 8:21803866-21803888 TCCTGTAATCCCAGTGCTTTGGG - Intronic
1037780541 8:21865460-21865482 ATCTGTAATCCCAGTGCTTTGGG + Intergenic
1037836044 8:22215301-22215323 GTCTGTAATCCCAGTGCTTTGGG + Intergenic
1037868689 8:22470244-22470266 ACCTATAATCCCAGTGCTTTGGG - Intronic
1037905218 8:22712360-22712382 GCCTATAATCCCAGTGCTTTGGG - Intergenic
1038027541 8:23605666-23605688 GTCTATAATCCCAGCGCTTTGGG - Intergenic
1038235544 8:25749946-25749968 GCCTATAATCCCAGTGCTTTGGG + Intergenic
1038278805 8:26143986-26144008 GTCCATAATCCCAGCACTGTGGG + Intergenic
1038492091 8:27978768-27978790 GTCTGTAATCCCAGTGCTTTGGG - Intronic
1038524125 8:28258623-28258645 AAAAATAATCCCAGTGCTTTGGG - Intergenic
1038534152 8:28342083-28342105 GCCTATAATCCCAGTGCTTTGGG + Intronic
1038730486 8:30122403-30122425 GCCAATAATCCCAGTACTTTGGG - Intronic
1038812250 8:30860369-30860391 GCCTATAATCCCAGTGCTTTGGG - Intronic
1038845377 8:31224169-31224191 GCCTGTAATCCCAGTGCTGTGGG - Intergenic
1039061559 8:33575800-33575822 CCTTATAATCCCAGTGCTGTGGG + Intergenic
1039291130 8:36095448-36095470 ATCTATAATCCCAGCGCTTTTGG + Intergenic
1039359961 8:36865504-36865526 GCCTATAATCCCAGTGCTTTAGG + Intronic
1039379365 8:37070548-37070570 GTCTATAATCCAAGTGCTTTGGG - Intergenic
1039429185 8:37512240-37512262 GCCTATAATCCCAGTGCTTTGGG + Intergenic
1039552612 8:38453972-38453994 ACCTATAATCCCAGTACTGTGGG - Intronic
1039589740 8:38736353-38736375 GCCTATAATCCCAGTGCTTTGGG + Intronic
1039695041 8:39901741-39901763 TCCTGTAATCCCAGTGCTTTCGG - Intergenic
1039749022 8:40459508-40459530 TCCCATAATTCCAGTGCTTTGGG + Intergenic
1039855917 8:41413862-41413884 ATCTGTAATCCCAGTGCTTTGGG - Intergenic
1039910191 8:41820453-41820475 TCCTGTAATCCCAGTGCTTTGGG - Intronic
1039918561 8:41877032-41877054 ATCTGTAATCCCAGTGCTTTGGG + Intronic
1039945023 8:42121526-42121548 ATCTATAATCCCAATGCTTTGGG - Intergenic
1040996945 8:53412064-53412086 GTCCATAATCCCAGTACTTTGGG + Intergenic
1041113994 8:54516675-54516697 TCCTATAATCCCAGCACTGTGGG + Intergenic
1041794551 8:61733087-61733109 GCCGATAATCCCAGTGCTTTGGG + Intergenic
1042638717 8:70908619-70908641 TTCAATTATTCCACTGCAGTGGG + Intergenic
1042920966 8:73919235-73919257 TCCTATAATCCCAGCACTGTGGG + Intergenic
1042986066 8:74584328-74584350 GCCTATAATCCCAGTGCTTTAGG + Intergenic
1043032939 8:75161086-75161108 TTTTATAATCCCAGTACTTTGGG + Intergenic
1043033849 8:75172028-75172050 GGCTATAATCCCAATGCTGTGGG + Intergenic
1043168163 8:76930668-76930690 TCCTGTAATCCCAGTGCTTTGGG - Intergenic
1043320365 8:78977104-78977126 TTCTGTAATCCCAGTACTTTGGG - Intergenic
1043460036 8:80450396-80450418 GTCTGTAATCCCAGTGCTTTGGG + Intergenic
1043511531 8:80954855-80954877 ACCTATAATCCCAGTGCTTTGGG - Intergenic
1043785480 8:84393280-84393302 TTCAGTACTTCAAGTGCTGTTGG + Intronic
1043924853 8:86025490-86025512 TTCTATAATCCCAGTATTTTGGG + Intronic
1043927742 8:86057181-86057203 ATTTATAATCCCAGTGCTTTGGG - Intronic
1044168499 8:89019323-89019345 TGCCTTAATCCCAGTGCTTTAGG + Intergenic
1044432283 8:92122551-92122573 ATCTGTAATCCCAGTGCTTTGGG - Intergenic
1044698464 8:94946439-94946461 GTCTATAATCCCAGTGCTTTGGG + Intronic
1045057066 8:98378286-98378308 TTCAAGAAGCCAAGTGCTGGAGG - Intergenic
1045153972 8:99444906-99444928 ACCTATAATCCCAGTGCTTTTGG - Intronic
1045502583 8:102754843-102754865 ATCTGTAATCCCAGTGCTTTGGG + Intergenic
1045622917 8:104003671-104003693 ACCTATAATCCCAGTGCTTTGGG - Intronic
1045661168 8:104439521-104439543 TCCTGTAATCCCAGTGCTGTGGG + Intronic
1045756544 8:105549871-105549893 GTCTGTAATCCCAGTGCTTTGGG - Intronic
1046170020 8:110493423-110493445 TCCTATAATCCCAGAGCTTTGGG + Intergenic
1047036334 8:120942814-120942836 TCCTGTAATCCCAGTGCTTTGGG - Intergenic
1047200069 8:122757735-122757757 TTCAATACTCTCAGTCCTGTGGG - Intergenic
1047653038 8:126945288-126945310 GTCTATAATCCCAGTGCTTTGGG - Intergenic
1047683899 8:127283929-127283951 TTCAATCATCCCAATGATGCAGG + Intergenic
1047935798 8:129777027-129777049 GCCTATAATCCCAGTGCTTTGGG - Intronic
1047991877 8:130295002-130295024 ATCTGTAATCCCAGTGCTTTGGG + Intronic
1048482316 8:134810010-134810032 TTCAGTTATCTGAGTGCTGTGGG - Intergenic
1048733001 8:137464572-137464594 ATCAAAATTTCCAGTGCTGTAGG + Intergenic
1049970095 9:814506-814528 GCCTATAATCCCAGTGCTCTGGG + Intergenic
1050152129 9:2627603-2627625 ACCTATAATCCCAGTGCTTTTGG + Intronic
1050227100 9:3471857-3471879 TTCAGTAATCGCAGTGCATTTGG - Intronic
1050519653 9:6484333-6484355 GCCTATAATCCCAGTGCTTTGGG - Intronic
1050620341 9:7445719-7445741 TTCCATAAACCCAGTGATGCAGG + Intergenic
1051312720 9:15793804-15793826 ATCAATAATCCCAGCACTTTGGG - Intronic
1051611768 9:18968302-18968324 ATCTGTAATCCCAGTGCTTTGGG - Intronic
1051756312 9:20404763-20404785 GCCTATAATCCCAGTGCTTTGGG - Intronic
1051782774 9:20708507-20708529 TGTAGTAATCCCAGTGCTTTGGG + Intronic
1051939876 9:22492847-22492869 GTCCATAATCCCAGTACTTTGGG - Intergenic
1052589440 9:30472223-30472245 TCCTATAATCCCAGCGCTTTAGG - Intergenic
1052808734 9:33037420-33037442 ACCTATAATCCCAGTGCTTTGGG + Intronic
1052815164 9:33097043-33097065 TTCTATAATCCCAGCACTTTGGG - Intergenic
1052841948 9:33299423-33299445 TTCTGTAATCCCAGTACTTTGGG + Intronic
1052917595 9:33935524-33935546 GCCCATAATCCCAGTGCTTTGGG - Intronic
1052961927 9:34305863-34305885 GCCTATAATCCCAGTGCTTTGGG - Intronic
1053211320 9:36230852-36230874 ACCTATAATCCCAGTGCTTTGGG - Intronic
1053341902 9:37344051-37344073 TTCTGTAATCCTAGTGCTTTTGG + Intronic
1053449919 9:38184955-38184977 GCCTATAATCCCAGTACTGTGGG + Intergenic
1053488579 9:38482009-38482031 TCCCGTAATCCCAGCGCTGTGGG - Intergenic
1054943386 9:70768659-70768681 ATCGATAATCCCAGTGCTTTGGG + Intronic
1056055947 9:82824285-82824307 CCCTATAATCCCAGTGCTTTGGG - Intergenic
1056157343 9:83851613-83851635 GCCTATAATCCCAGTGCTTTGGG - Intronic
1056162624 9:83911788-83911810 TTCTGTAATCCCAGTACTTTGGG - Intronic
1056212484 9:84377677-84377699 TCCTATAATCCCAGTTCTTTGGG - Intergenic
1056353201 9:85772486-85772508 GCCTATAATCCCAGTGCTTTAGG + Intergenic
1056380956 9:86056923-86056945 TCCTGTAATCCCAGTGCTGCAGG - Intronic
1056430998 9:86527651-86527673 ATCTGTAATCCCAGTGCTTTGGG + Intergenic
1056614598 9:88153004-88153026 ATCTATAATCCCAGAGCTTTGGG - Intergenic
1057452848 9:95180596-95180618 GCCTATAATCCCAGTGCTTTGGG - Intronic
1057466987 9:95323312-95323334 GCCTATAATCCCAGTGCTTTGGG + Intergenic
1057530782 9:95844005-95844027 AGCTATAATCCCAGTGCTTTGGG - Intergenic
1057668935 9:97071305-97071327 TCCCGTAATCCCAGCGCTGTGGG - Intergenic
1057853815 9:98586557-98586579 TTCTATAATCCCAGCACTTTGGG - Intronic
1058047210 9:100369386-100369408 GTCAGTAATCCCAGTGCCTTAGG + Intergenic
1058062970 9:100518205-100518227 GTCTGTAATCCCAGTGCTTTGGG + Intronic
1058729369 9:107835411-107835433 GCCTATAATCCCAGTGCTTTGGG + Intergenic
1058940892 9:109811934-109811956 TAGATGAATCCCAGTGCTGTTGG + Intronic
1059198240 9:112391204-112391226 TTCTATAATCCCAGTGCTTTGGG + Intronic
1059250878 9:112886986-112887008 TCCTGTAATCCCAGTGCTTTGGG - Intronic
1059319687 9:113459488-113459510 GCCTATAATCCCAGCGCTGTGGG + Intronic
1059910398 9:119037217-119037239 TTTATTTATCCCAGTGCTGAAGG - Intergenic
1059932216 9:119272340-119272362 TCCTATAATCCCAGCGCTTTGGG - Intronic
1060199424 9:121643906-121643928 ACCTATAATCCCAGTGCTTTGGG + Intronic
1060259342 9:122060364-122060386 TCCAGAAATCCCAGTGCTCTAGG + Intronic
1060411099 9:123400838-123400860 TTAAATAATCCCAGCACTTTGGG - Intronic
1060469594 9:123937081-123937103 GCCTATAATCCCAGTGCTTTGGG + Intergenic
1060640832 9:125237454-125237476 TGTAATAATCCCAGTACTTTGGG + Intronic
1060837921 9:126771363-126771385 GTCTGTAATCCCAGTGCTTTGGG - Intergenic
1060862489 9:126966257-126966279 GCCTATAATCCCAGTGCTGTGGG + Intronic
1060867184 9:127009839-127009861 ATCAACAAACCCAGGGCTGTGGG - Intronic
1060955972 9:127640160-127640182 ATCTATAATCCCAGTACTTTGGG - Intronic
1061066015 9:128277829-128277851 CTCAATCAGCCCAGTGCTTTTGG - Intronic
1061174051 9:128981535-128981557 GTCTATAATCCCAGTGCTTTGGG - Intronic
1061285076 9:129617941-129617963 GCCTATAATCCCAGTGCTTTGGG - Intronic
1061301252 9:129706184-129706206 ACCTATAATCCCAGTGCTTTGGG + Intronic
1061435276 9:130557376-130557398 GCCTATAATCCCAGTGCTTTGGG + Intergenic
1061555414 9:131365237-131365259 GCCCATAATCCCAGTGCTTTGGG - Intergenic
1061730173 9:132607786-132607808 ACCTATAATCCCAGTGCTTTGGG - Intronic
1061853926 9:133431222-133431244 GTCTGTAATCCCAGTGCTTTGGG - Intronic
1062211683 9:135367810-135367832 GCCTATAATCCCAGTGCTTTGGG + Intergenic
1062714657 9:138002447-138002469 GCCTATAATCCCAGTGCTTTGGG + Intronic
1202788346 9_KI270719v1_random:55455-55477 GCCAATAATCCAAGTGCTTTGGG - Intergenic
1203428545 Un_GL000195v1:66058-66080 GCCTGTAATCCCAGTGCTGTGGG - Intergenic
1203611244 Un_KI270749v1:7234-7256 TTGAAAAATTCCATTGCTGTTGG + Intergenic
1185793982 X:2949188-2949210 TCCTGTAATCCCAGTGCTTTTGG - Intronic
1185852088 X:3498699-3498721 AGCTATAATCCCAGTGCTTTGGG + Intergenic
1185941975 X:4332035-4332057 GCCAGTAATCCCAGTGCTTTGGG - Intergenic
1185987538 X:4852525-4852547 GCCTATAATCCCAGTGCTTTGGG - Intergenic
1186142703 X:6593729-6593751 GCCTATAATCCCAGTGCTTTTGG + Intergenic
1186210977 X:7250185-7250207 ACCTATAATCCCAGTGCTTTGGG - Intronic
1186414543 X:9371864-9371886 ATCTATAATCCCAGTGCTTTGGG + Intergenic
1186421836 X:9432874-9432896 GTCTGTAATCCCAGTGCTTTGGG + Intergenic
1186471625 X:9826510-9826532 TCCTGTAATCCCAGTGCTTTGGG + Intronic
1186476456 X:9861427-9861449 ATCTGTAATCCCAGTGCTTTGGG - Intronic
1186479096 X:9882513-9882535 TTCTATAAACCCATTACTGTTGG - Intronic
1186484679 X:9924913-9924935 ACCTATAATCCCAGTGCTGTGGG - Intronic
1186759891 X:12712287-12712309 GCCTATAATCCCAGTGCTTTGGG + Intronic
1186980397 X:14952298-14952320 ATCTATAATCCCAGTGCTTTGGG + Intergenic
1187059214 X:15770052-15770074 GTCTGTAATCCCAGTGCTTTGGG + Intronic
1187100901 X:16190613-16190635 TCCTGTAATCCCAGTGCTTTGGG + Intergenic
1187187162 X:16997983-16998005 TTCCATAATCCCAGCACTTTGGG + Intronic
1188067837 X:25683127-25683149 TTCATTAATCCCAGTCTTGAAGG - Intergenic
1188103045 X:26114330-26114352 GCCTATAATCCCAGTGCTTTGGG - Intergenic
1188174441 X:26971949-26971971 TTCCATAATCCCAGCACTTTGGG + Intergenic
1188572992 X:31611818-31611840 TTCTGTAATCCCAGAACTGTGGG - Intronic
1188786417 X:34352212-34352234 ATCTGTAATCCCAGTGCTTTGGG + Intergenic
1189261423 X:39681504-39681526 CTCAATAATGCCAGTACTGGAGG - Intergenic
1189327906 X:40124172-40124194 GCCTATAATCCCAGTGCTTTGGG + Intronic
1189653870 X:43220558-43220580 TCCTATAACCCCAGTGCTTTGGG - Intergenic
1189799417 X:44677991-44678013 CTCAGTAATCCCAGTGCTTTGGG - Intergenic
1190170201 X:48106358-48106380 TCCTATAATCCCAGTGTTTTGGG + Intergenic
1190188114 X:48253714-48253736 TCCTGTAATCCCAGTGCTTTGGG + Intronic
1190893389 X:54591331-54591353 TCCTGTAATCCCAGTGCTTTGGG + Intergenic
1190948462 X:55118917-55118939 TCCCATAATCCCAGTACTTTGGG + Intronic
1191852672 X:65597306-65597328 ATCTGTAATCCCAGTGCTTTGGG - Intronic
1192129670 X:68537551-68537573 ACCTATAATCCCAGTGCTTTGGG + Intergenic
1192400639 X:70831365-70831387 GTCTATAATCCCAGTACTTTGGG + Intronic
1193053431 X:77125339-77125361 TTCTATGGTTCCAGTGCTGTGGG + Intergenic
1193089493 X:77478932-77478954 ACCTATAATCCCAGTGCTTTGGG + Intergenic
1193120276 X:77816066-77816088 AACTATAATCCCAGTGCTTTGGG - Intergenic
1194085143 X:89517059-89517081 ATCAATAATCCCAACACTGTGGG - Intergenic
1194808587 X:98362216-98362238 TCCTAAAATCCCAGTGCTTTGGG - Intergenic
1195137621 X:101925445-101925467 TTCCAACATCCCAGTACTGTAGG - Intronic
1195257039 X:103101051-103101073 ACCCATAATCCCAGTGCTTTGGG - Intergenic
1195632352 X:107070760-107070782 TCCTGTAATCCCAGTGCTTTGGG + Intronic
1195757365 X:108212588-108212610 ACCAATAATCCCTGTGCTGAAGG - Intronic
1196107130 X:111908875-111908897 ATCTGTAATCCCAGTGCTTTGGG + Intronic
1196345983 X:114659225-114659247 TCCCATAATCCCTGTGTTGTGGG - Intronic
1196401521 X:115322100-115322122 TTCAGTATTCCAAATGCTGTTGG + Intergenic
1196428813 X:115600384-115600406 GCCTATAATCCCAGTGCTTTGGG - Intronic
1196647872 X:118137269-118137291 CCCTATAATCCCAGTGCTTTGGG - Intergenic
1196928867 X:120661313-120661335 GCCTATAATCCCAGTGCTGTGGG + Intergenic
1196991569 X:121334984-121335006 ATCTGTAATCCCAGTGCTTTGGG + Intergenic
1197212020 X:123836063-123836085 GCCTATAATCCCAGTGCTTTGGG - Intergenic
1197237008 X:124078707-124078729 TCCTGTAATCCCAGTGCTTTGGG + Intronic
1197712874 X:129684645-129684667 GCCTATAATCCCAGTGCTTTGGG - Intergenic
1197779572 X:130146176-130146198 GTCTATAACCCCAGTGCTTTGGG + Intronic
1198090135 X:133320746-133320768 GTCTGTAATCCCAGTGCTTTGGG + Intronic
1198179233 X:134189174-134189196 ACCTATAATCCCAGTGCTTTGGG - Intergenic
1198184591 X:134240934-134240956 ATCTGTAATCCCAGTGCTTTGGG - Intronic
1198550464 X:137740021-137740043 TCCTATAATCCCAGTACTTTGGG + Intergenic
1198582876 X:138086062-138086084 GCCTATAATCCCAGTGCTTTGGG - Intergenic
1199891858 X:152092527-152092549 CTCAGTAATCCCAGTACTTTGGG + Intergenic
1200096064 X:153663142-153663164 GCCTATAATCCCAGTGCTTTGGG + Intergenic
1200281132 X:154778024-154778046 ACCTATAATCCCAGTGCTTTGGG + Intergenic
1200368422 X:155694062-155694084 GCCTATAATCCCAGTGCTTTGGG - Intergenic
1200437791 Y:3172943-3172965 ATCAATAATCCCAACACTGTGGG - Intergenic
1200746253 Y:6906587-6906609 CTCCATAATCCCAGCGCTTTGGG - Intergenic
1200810728 Y:7481916-7481938 AGCTATAATCCCAGTGCTTTGGG - Intergenic
1201181095 Y:11346435-11346457 GTCCATAATGCCAGTGCTTTGGG - Intergenic
1201396196 Y:13551943-13551965 ACCTGTAATCCCAGTGCTGTGGG + Intergenic
1201638987 Y:16158673-16158695 TTCTATAATCCCAGCACTTTGGG - Intergenic
1201694654 Y:16811565-16811587 ACCTATAATCCCAGTGCTTTGGG - Intergenic
1202371399 Y:24199163-24199185 GTCTGTAATCCCAGTGCTTTGGG + Intergenic
1202499386 Y:25470952-25470974 GTCTGTAATCCCAGTGCTTTGGG - Intergenic