ID: 1168993700

View in Genome Browser
Species Human (GRCh38)
Location 20:2116457-2116479
Sequence CTGGGTTTGGAATGAGGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 398
Summary {0: 1, 1: 2, 2: 5, 3: 46, 4: 344}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168993700_1168993706 -2 Left 1168993700 20:2116457-2116479 CCTGGGCCTCATTCCAAACCCAG 0: 1
1: 2
2: 5
3: 46
4: 344
Right 1168993706 20:2116478-2116500 AGGTACCTGACACCAGTCCCTGG 0: 1
1: 1
2: 3
3: 37
4: 606
1168993700_1168993711 22 Left 1168993700 20:2116457-2116479 CCTGGGCCTCATTCCAAACCCAG 0: 1
1: 2
2: 5
3: 46
4: 344
Right 1168993711 20:2116502-2116524 GCCTGTGTCATACCTTAGAAAGG 0: 1
1: 0
2: 0
3: 7
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168993700 Original CRISPR CTGGGTTTGGAATGAGGCCC AGG (reversed) Intronic
900249471 1:1659930-1659952 ATGGGTTTGGAGTGGGGCCCTGG - Intronic
900260407 1:1725241-1725263 ATGGGTTTGGAGTGGGGCCCTGG - Intronic
901018949 1:6246256-6246278 CCGGGCTTGGAATGTGGGCCAGG - Intergenic
901138261 1:7011542-7011564 CTGGGTCTGGAATGAGGAGAGGG - Intronic
901692053 1:10980169-10980191 CTGGGCTGGGCCTGAGGCCCTGG - Intronic
903619826 1:24689959-24689981 CTGGGTTTTTCATGTGGCCCAGG + Intergenic
903836195 1:26204644-26204666 CTGAGTTAGGAGTGGGGCCCCGG + Intergenic
904011932 1:27394850-27394872 GGGGGTTTGGAAAGAAGCCCTGG - Exonic
904910941 1:33933763-33933785 CTGAGTTAGGAATGGGGCCTGGG + Intronic
905044452 1:34985045-34985067 CTGGCTTTCGACTGAGGCGCAGG - Intronic
906520115 1:46461841-46461863 CTGGGTGTGGGCAGAGGCCCTGG + Intergenic
907319432 1:53593557-53593579 CAGGGTTTGGGCTGGGGCCCAGG - Intronic
910266442 1:85342856-85342878 CTGGGTCTGGAATGGAACCCAGG - Intronic
913023449 1:114810218-114810240 CTGGGTTTAGGATGAGGCAAGGG + Intergenic
913096403 1:115521244-115521266 CTGGGTTTGGGGGGTGGCCCTGG - Intergenic
913320721 1:117586771-117586793 CTGGGTTTGAAGTGGGGACCAGG - Intergenic
915548818 1:156619811-156619833 CTGGGGTTGGGATGAGGGCTGGG - Intronic
915979516 1:160411155-160411177 CTGGGGTTAAAATGAGGCCAGGG - Intronic
916121392 1:161531336-161531358 CTGGGTTTAGAAAGAGGCCAGGG - Intergenic
916131161 1:161612916-161612938 CTGGGTTTAGAAAGAGGCCAGGG - Intronic
916876322 1:168973362-168973384 CTGTGCTTGGAATGAAGCCATGG + Intergenic
917415963 1:174809497-174809519 CTGGATTTGAAATTAGGCCTTGG + Intronic
918190032 1:182164794-182164816 CTTGGATTGGAATGAAGCCAAGG + Intergenic
919668148 1:200312481-200312503 CTGTGATAGGAATGAGGACCAGG - Intergenic
920131731 1:203737182-203737204 CTGGGGTTGGAGTGAGGGTCTGG - Intronic
920427848 1:205892657-205892679 CCCAGTTTGGAATGGGGCCCAGG - Intergenic
922733752 1:227968578-227968600 CTGGGTCTGGAAAAAGCCCCTGG - Intergenic
922775286 1:228211717-228211739 TGGGGATTGGAATGAGGCCCGGG - Intronic
924416870 1:243865071-243865093 CTGAGGGTGGAATGCGGCCCAGG - Intergenic
1063046413 10:2397084-2397106 AGGGGTGGGGAATGAGGCCCAGG - Intergenic
1064723829 10:18257448-18257470 CTGAGTTTAGAATGAGGACTTGG + Intronic
1066612594 10:37265590-37265612 CTTGATCTGGAAGGAGGCCCAGG - Intronic
1066988397 10:42488709-42488731 CCTGGTTTGGAATGGGGCCTGGG - Intergenic
1066989258 10:42496864-42496886 CCCGGTTTAGAATGGGGCCCGGG - Intergenic
1066990575 10:42509459-42509481 CCCAGTTTAGAATGAGGCCCAGG + Intergenic
1067285976 10:44907976-44907998 CTGGGTTGGGAAGGATGTCCCGG - Intergenic
1067962771 10:50874932-50874954 GCTGGTTTGGAATGGGGCCCAGG + Intronic
1069056447 10:63849393-63849415 CCTGGTTTGGAATGGGGCCCGGG - Intergenic
1069491716 10:68866838-68866860 CCTGGTTTGGAACGGGGCCCAGG + Intronic
1069654501 10:70077787-70077809 CTGGATCTGGAGTGAGGCCAAGG + Intronic
1070766451 10:79059314-79059336 CAGGGTTGGGATTGAGGGCCAGG + Intergenic
1072436105 10:95415922-95415944 CTGGGGTTGGGATGAAGCACTGG + Intronic
1072913844 10:99525129-99525151 TTGAGTTTGGGATGGGGCCCAGG - Intergenic
1073421344 10:103426007-103426029 ATGGGTTTGGAGTCAGACCCGGG + Intronic
1073601712 10:104852498-104852520 GTGGGATTAGAATAAGGCCCAGG - Intronic
1074626689 10:115197648-115197670 CTGGCTTTGGTATGGGGTCCTGG - Intronic
1074778610 10:116784727-116784749 CTGGCTGAGGAATGAGTCCCTGG + Intergenic
1076152533 10:128174258-128174280 CAGGGTTTGCCATGTGGCCCAGG + Intergenic
1077371201 11:2182403-2182425 GTGGGTCTGGACCGAGGCCCTGG - Intergenic
1079479035 11:20861633-20861655 CTGGGTTTGTGATGAGGGTCAGG + Intronic
1079979065 11:27129874-27129896 ATGGGTCTGGGATGAGGACCAGG + Intergenic
1080160605 11:29170744-29170766 ATTGGTCTGGAATGAGGCCTGGG + Intergenic
1081254429 11:40874747-40874769 CTGGATTTGCAATGAGGCCAGGG + Intronic
1081472185 11:43384634-43384656 CTGGTTTTGGTATGTGACCCAGG - Intronic
1081977462 11:47244820-47244842 CATGGTTTGGGGTGAGGCCCAGG + Exonic
1082009811 11:47442291-47442313 GTGGGTTTGGGATGAGGCTGGGG + Intronic
1082288468 11:50341981-50342003 GTTGGCTTGGAATGGGGCCCAGG - Intergenic
1082763015 11:57144920-57144942 CAGGCTTTGGAATCAGCCCCTGG + Intergenic
1083096148 11:60253602-60253624 CTGTGTTTGGAAGGAGGGCTTGG + Intergenic
1083886032 11:65573959-65573981 CTGGGATTGGGATGAGTGCCTGG + Exonic
1084272683 11:68037656-68037678 CTGGTCTAGGAAGGAGGCCCAGG - Intergenic
1084285511 11:68128352-68128374 CTGGCCTTGGAATTCGGCCCGGG - Intergenic
1085532139 11:77198198-77198220 GAGGGGTTGGACTGAGGCCCAGG - Intronic
1086589579 11:88496146-88496168 CTGGCTATAGAATGAGGCGCAGG + Intergenic
1087173055 11:95069950-95069972 CTGGGGATAGAATGAGACCCAGG + Exonic
1087706070 11:101493332-101493354 GTGGGTTGGACATGAGGCCCAGG - Intronic
1089322632 11:117636667-117636689 CTGGCTTTAGAATCAGGTCCTGG + Intronic
1090073046 11:123560780-123560802 CTGGGGTCAGAATGGGGCCCTGG + Intronic
1090621206 11:128562618-128562640 CTGGGAATGAAATGAAGCCCCGG + Intronic
1091457655 12:619683-619705 CTGGGTTTAGAATGATTCCTTGG + Intronic
1091566098 12:1649264-1649286 CTGGGCTGGGAATCAGGACCAGG - Intergenic
1093780000 12:23123826-23123848 GTAGGTTTGGAGTGAGGCCCAGG - Intergenic
1096450729 12:51738959-51738981 CCTGGTTTAGAATGGGGCCCGGG + Intronic
1096936848 12:55289759-55289781 CTGGGTTTGCCATGTTGCCCAGG + Intergenic
1097140822 12:56901259-56901281 ATGGGACTGGAAGGAGGCCCTGG + Intergenic
1097705809 12:62867037-62867059 CTGGGTTGTGAATGAGCCACAGG - Intronic
1099425209 12:82515350-82515372 ATGGGTTTGGAGTGGGGCCCAGG - Intergenic
1100474748 12:94925020-94925042 CTGGGTTTGGAAAGTGACTCAGG - Intronic
1102719477 12:115003713-115003735 CTGGGATTGGGTGGAGGCCCAGG - Intergenic
1103343242 12:120232483-120232505 TTGGGCCTGGAATGGGGCCCTGG - Intronic
1104735818 12:131135585-131135607 CTGGGCCTGAAATGAGGCCATGG - Intronic
1104779947 12:131413613-131413635 CTGGCAATGGAAGGAGGCCCTGG + Intergenic
1105710835 13:23007522-23007544 CTCGGTTTGGAATGGGGCCCAGG - Intergenic
1105978914 13:25498840-25498862 CTGGGTCTGCCATGAGCCCCAGG - Intronic
1106236460 13:27865286-27865308 CTGAGTTGGGATTGAGACCCAGG - Intergenic
1106787282 13:33120013-33120035 CTGATTTTGGAAGGAGGCCCAGG + Intronic
1107542800 13:41408782-41408804 GTGGGTCTGGAGTGGGGCCCAGG - Intergenic
1107660576 13:42635197-42635219 CTGGGTTTAGAGTGGGGCTCAGG - Intergenic
1110223145 13:73093900-73093922 CTGGGTGTGGTGAGAGGCCCAGG + Intergenic
1112025901 13:95410674-95410696 CAGGGTTTGCCATGTGGCCCAGG - Intergenic
1112151730 13:96772066-96772088 CTGGGTTTGTGATGGGGCCAGGG + Intronic
1113614614 13:111671485-111671507 GTGGGTCTGGAAGAAGGCCCGGG + Intronic
1113620081 13:111756399-111756421 GTGGGTCTGGAAGAAGGCCCGGG + Intergenic
1117082397 14:52165679-52165701 CCTGGTTTGGAATGGGGCCCAGG - Intergenic
1117207310 14:53457019-53457041 CTGGGTCTGCAATGTGACCCTGG - Intergenic
1117372832 14:55094340-55094362 CTGGGTTTGGAAAGAGACCCAGG - Intergenic
1119613319 14:76082093-76082115 CAGGTTCTGGAATGAGGCCTGGG + Intronic
1120415618 14:84215228-84215250 CTGCCTTTGCAATAAGGCCCAGG - Intergenic
1121366549 14:93317386-93317408 CAGGGTTTGGTATGTCGCCCAGG + Intronic
1121972464 14:98370774-98370796 TTGGGTTTGGAAAGAGCCTCTGG + Intergenic
1122601806 14:102925325-102925347 CTGGGGTGGAAATGAGGCCCAGG - Intronic
1122652927 14:103235969-103235991 CCCGGTTTGGAATGGGGCCCGGG - Intergenic
1122946832 14:105015162-105015184 TTGGGTTTGGACTCAGGACCTGG - Intronic
1123467014 15:20525020-20525042 GTGGGTCTGGAACCAGGCCCTGG + Intergenic
1123651100 15:22476022-22476044 GTGGGTCTGGAACCAGGCCCTGG - Intergenic
1123741508 15:23284864-23284886 GTGGGTCTGGAACCAGGCCCTGG - Intergenic
1123745489 15:23317694-23317716 GTGGGTCTGGAACCAGGCCCTGG + Intergenic
1124069145 15:26375341-26375363 CTGCATTTGCAATGAGGCCTTGG - Intergenic
1124277761 15:28341011-28341033 GTGGGTCTGGAACCAGGCCCTGG + Intergenic
1124304940 15:28570597-28570619 GTGGGTCTGGAACCAGGCCCTGG - Intergenic
1124822938 15:33066010-33066032 CTGGATTTAGAATGAGACCTGGG - Intronic
1124896605 15:33783203-33783225 GTCAGTTTGGAGTGAGGCCCAGG + Intronic
1124931369 15:34122862-34122884 GTTGGTCTGGAATGGGGCCCTGG + Intergenic
1126055871 15:44729167-44729189 CTGGGCTGGGAAGGAGGACCGGG - Exonic
1127123659 15:55792094-55792116 CTGGGCTTGGAAGGAGGCAAGGG - Intergenic
1128060447 15:64732190-64732212 CTGGGTCTGGAAAGAGACACAGG + Intergenic
1128136930 15:65270760-65270782 CTGTGTCTGGAGTCAGGCCCAGG - Intronic
1128565405 15:68697780-68697802 CTGGGCTGGGAAAGAGGCACAGG + Intronic
1129692605 15:77722283-77722305 CTGGGTTTATCAGGAGGCCCAGG + Intronic
1130406849 15:83610181-83610203 CTGGGCTTGGAATGAGCCTTTGG - Intronic
1131050756 15:89346334-89346356 CTGGGTCTGGCTAGAGGCCCTGG + Intergenic
1131261243 15:90889210-90889232 CTGGGTTTGGAGTCAGGGCTGGG - Intronic
1132363630 15:101239426-101239448 CTGGCTCTGGAATCAGGCCATGG + Intronic
1133142625 16:3758928-3758950 CTAGGGTTGGCATGAGGGCCTGG + Exonic
1133676233 16:8075509-8075531 TTGCTTTTGGAAAGAGGCCCTGG - Intergenic
1134240514 16:12502538-12502560 CAGGGCTGGGAATGAGGCCCCGG - Intronic
1136061728 16:27731192-27731214 CTAAGTTTGGGTTGAGGCCCTGG - Intronic
1136568610 16:31084086-31084108 CAGGGTTTGGCAGGAGGCCCCGG + Exonic
1136631107 16:31489730-31489752 CTGGGTGTGGAAGGATGGCCGGG + Exonic
1137373392 16:47929576-47929598 TGGGGTCTGGAATGATGCCCAGG + Intergenic
1138261365 16:55625669-55625691 CTGGATTTGGTCTGAGGCCAAGG + Intergenic
1138344417 16:56311431-56311453 CTGGGTATGGGGTCAGGCCCGGG - Intronic
1138566338 16:57835998-57836020 CTGGGTTGGAAGTGAGGGCCTGG - Intronic
1138619351 16:58198538-58198560 CTGAGGTTTGAGTGAGGCCCTGG - Intergenic
1139336272 16:66233829-66233851 CTGGGTTTGGAATAAGGTTCAGG - Intergenic
1139752892 16:69119992-69120014 CTGGGGTTAGACAGAGGCCCTGG + Exonic
1141490286 16:84368190-84368212 CTGGGTTTTTAACGAGCCCCAGG - Intergenic
1141573446 16:84948581-84948603 CTGGGGCTGAAATGGGGCCCTGG + Intergenic
1141755396 16:85987595-85987617 CTGGATGTGGCATGAGCCCCTGG - Intergenic
1142661942 17:1436723-1436745 CTGGGTTGGGCATAGGGCCCAGG + Exonic
1143430505 17:6879556-6879578 CCCGGTTTAGAATGGGGCCCGGG + Intronic
1143583336 17:7838862-7838884 CTGGCTTAGGAAGGAGGCCTTGG + Intergenic
1146946449 17:36876947-36876969 ATTGGTTTGGAGTGAGCCCCAGG - Intergenic
1147903147 17:43803744-43803766 GGGGGTTTGGAGTGGGGCCCAGG - Intronic
1147905036 17:43817058-43817080 CTGGGGTTGGAGTCTGGCCCTGG + Intronic
1148080236 17:44963980-44964002 CTGGGTTGGCAGTGGGGCCCTGG - Intronic
1149656135 17:58310518-58310540 CAGGGTCTGGGCTGAGGCCCAGG - Exonic
1150219302 17:63487111-63487133 CTGGGACTGGCATGGGGCCCGGG + Intronic
1151413075 17:73943846-73943868 CTGGCTTTGGAATGGTGCCTGGG + Intergenic
1152351432 17:79785904-79785926 CTGGGTTTGGAAGGGGACTCAGG - Exonic
1152388115 17:79987146-79987168 TTGAGTTTGGGATGAGGGCCTGG - Intronic
1153003336 18:475839-475861 CTGGGTTTGGAAGGAGGGAACGG + Intronic
1153520823 18:5952432-5952454 GGGGCTTTGGAGTGAGGCCCAGG - Intergenic
1154349666 18:13572419-13572441 CTGGGAGTGGAAGGAGGCTCTGG + Intronic
1154491424 18:14925184-14925206 CTGGGTTTGGATAGAGGCTGAGG + Intergenic
1155500406 18:26481827-26481849 ATTGGTTGGGAATGAAGCCCAGG + Intronic
1157333765 18:46722274-46722296 CTGGGCTTGGGAAGAGGGCCTGG - Intronic
1157590254 18:48832361-48832383 CGGGGTTTGCCATGTGGCCCAGG + Intronic
1158634794 18:59147329-59147351 TTGAGTTTGGAGTGAGGACCTGG - Intronic
1158892822 18:61889037-61889059 CTGGGGTTGGGCTGAGGGCCAGG - Intronic
1160069704 18:75616041-75616063 CTGGGGTTGGAATGGGGACCAGG + Intergenic
1160250928 18:77202971-77202993 CTGGGAATGGAAGGAGGCTCCGG - Intergenic
1160949553 19:1658886-1658908 CTGGGTTTGGGCCGAGGGCCAGG + Intergenic
1161592829 19:5136524-5136546 CTGGGTTTGAGATGTGCCCCCGG + Intronic
1162252314 19:9456087-9456109 CCTGGTTTGGAATGTGGCTCAGG - Intergenic
1162642559 19:12023096-12023118 CTTGGTTTGGAATGGGGCCCGGG - Intronic
1163470902 19:17496466-17496488 CTGCGTCTGGACTGAGCCCCAGG - Intronic
1163782652 19:19258449-19258471 CTGGGTGGGGAAGAAGGCCCCGG + Intronic
1164697744 19:30259452-30259474 ATGGGTCTGGGGTGAGGCCCGGG - Intronic
1165490613 19:36120976-36120998 CTGGGGTGGGAATGAGGGCCGGG + Intronic
1165820962 19:38675808-38675830 CTGGGTATGGCAGGAGCCCCAGG - Intronic
1165923587 19:39313887-39313909 CTGGGCTTGGGAGGAGGCCCTGG + Intronic
1166659120 19:44634192-44634214 CCCAGTTTGGAATGGGGCCCAGG + Intronic
1167419647 19:49395392-49395414 CTGTGTTTGGAATGAGGCTGTGG + Intronic
1167863583 19:52305788-52305810 CCCGGTTTGGAATGAGGCCTGGG + Intronic
1168095502 19:54112433-54112455 CAGGGTTTGGAATATGCCCCTGG + Intronic
1168159616 19:54501023-54501045 CCGGGTGTGGAATGAGGAGCAGG - Intronic
1168499236 19:56879329-56879351 CTGTGTTTAGAATAAGGTCCTGG - Intergenic
1168562487 19:57395786-57395808 CTGGGCTTGGAATGAGGTTTTGG + Intronic
925232971 2:2252330-2252352 CTGGGTTCAGAAAGAGGCCATGG - Intronic
926203839 2:10820955-10820977 CTGGGTTTGGAAACTGACCCTGG + Intronic
927214897 2:20662738-20662760 CTGGGTATGGCAGGAGACCCTGG + Intergenic
927531155 2:23803473-23803495 CTCAATTTGGAATGAGTCCCAGG - Intronic
928212831 2:29336358-29336380 GTGGCTTTGGAAAGATGCCCTGG - Intronic
928445408 2:31329479-31329501 CTGGGTTTGGAAAGAGAAGCAGG + Intergenic
928702937 2:33917530-33917552 CCCTGTTTGGAATGGGGCCCGGG + Intergenic
929605860 2:43233734-43233756 ATGGGTTTGGAGGGAGGCTCAGG + Intronic
930176305 2:48304751-48304773 CTGGGTCTAGAATGGGGCCAGGG + Intergenic
930767318 2:55097322-55097344 CTGAGTCTGGACTGAGGCCAAGG - Intronic
931462585 2:62461673-62461695 GGGGGTCTGGAATGAGGCTCAGG - Intergenic
932311349 2:70744825-70744847 CCGGGCTTGGAATCAGGGCCTGG + Intronic
934041924 2:88134252-88134274 CTGAGTTTTGAAGGAGGCCAGGG - Intergenic
935165726 2:100567129-100567151 CAGTCTCTGGAATGAGGCCCAGG + Intronic
938945232 2:136206537-136206559 CTGAATTTGGACTGAGGTCCAGG + Intergenic
939691466 2:145267187-145267209 TTGGGCTTGGAATAAGACCCAGG + Intergenic
942062560 2:172241191-172241213 CTTGGTTTGGAGTTGGGCCCGGG - Intergenic
942221820 2:173776193-173776215 GTGGGGTTGACATGAGGCCCTGG + Intergenic
943062417 2:183052635-183052657 CCTGGTTTGGAATGGGGCCTGGG + Intergenic
943110559 2:183599585-183599607 GTAGGTCTGGAATGAGGCCTAGG + Intergenic
944094062 2:195946744-195946766 CTGGGTTTGGGACAAGGACCGGG - Intronic
944452414 2:199856638-199856660 CGGGGTTTGCTATGATGCCCAGG + Intergenic
946138020 2:217664172-217664194 GTGGGTTTGGGGTGAGGCCCAGG - Intronic
946399198 2:219459907-219459929 ATGGCTTGGGAATGTGGCCCCGG + Intronic
947575219 2:231268194-231268216 CTTGGTTTGGAATGGGGTTCTGG + Intronic
1168993700 20:2116457-2116479 CTGGGTTTGGAATGAGGCCCAGG - Intronic
1169859029 20:10132503-10132525 CTGGATTTGAAAGGAGGCCATGG - Intergenic
1170766120 20:19291224-19291246 TTCGGGGTGGAATGAGGCCCAGG + Intronic
1170899181 20:20444016-20444038 CTTGGTTTGGAATGGGGGCCAGG - Intronic
1170946735 20:20898042-20898064 CTTGATTTGGAATGGGCCCCAGG + Intergenic
1172293964 20:33795002-33795024 CTGGGGGTGGAGTGAGACCCTGG - Intergenic
1173606944 20:44338124-44338146 CTGGTTTTGGACAGTGGCCCTGG - Intronic
1174049008 20:47754483-47754505 CTGGGTTTTGAAGGAGGCAAGGG - Intronic
1175101842 20:56584868-56584890 GTGGGTCTGGGGTGAGGCCCAGG - Intergenic
1175916587 20:62428680-62428702 CTGGGTTTGGGATGAGGGCTGGG + Intergenic
1178481612 21:32984130-32984152 CTGTGTTGGAAGTGAGGCCCTGG - Intergenic
1178871397 21:36380075-36380097 CTGGGTTTGCCATGTTGCCCAGG + Intronic
1178964252 21:37100661-37100683 ATGGGGTTGGAATGAGGCAGGGG + Intronic
1179223664 21:39432670-39432692 CTGGGTTGGGAGTGAGGCGCAGG - Intronic
1179992980 21:44958251-44958273 CTGGGTTTGGGGCGAGGCCCAGG + Intronic
1180066431 21:45414838-45414860 CTGTGTGTGGGATGAGGCTCAGG + Intronic
1181338923 22:22163184-22163206 CTGTGTTTGGAATTACTCCCAGG - Intergenic
1181630887 22:24150752-24150774 CTGGGTTTGGAGTTAGACCTAGG + Intronic
1182343355 22:29642751-29642773 ATGAGTTTGGAGTGAGGACCTGG - Intronic
1182526005 22:30920146-30920168 CTGGGTTTGTGCTGAGGCCGAGG - Intergenic
1182663824 22:31943645-31943667 CTGGGTTTGGACTCAGATCCTGG + Intronic
1183225753 22:36548874-36548896 CTGGGCTGGGAAGGAGGCCATGG + Intergenic
1183721487 22:39565304-39565326 CTGGGATGGGAATGGTGCCCTGG - Intergenic
1184258084 22:43298397-43298419 CTGAGCTTGGACTCAGGCCCAGG - Intronic
1184637942 22:45850251-45850273 CTGGGAGTGAAAAGAGGCCCAGG + Intergenic
1185273870 22:49941575-49941597 CAGGGTGTGAACTGAGGCCCTGG - Intergenic
1185377235 22:50488163-50488185 CTGGGTTGGGGAGCAGGCCCTGG + Intronic
1185380977 22:50507475-50507497 CGGGGTTGGGAGTGAGGGCCAGG - Intronic
949454068 3:4219756-4219778 ATGGATTTGGGATGATGCCCAGG - Intronic
949893181 3:8748433-8748455 CAGGGTGTGGAAGGGGGCCCTGG - Intronic
949930041 3:9071361-9071383 CTGGGGTGGGCATGAGACCCTGG + Intronic
950040833 3:9918122-9918144 CTGGGGTGGGCATGAGGGCCAGG + Intronic
950265305 3:11568893-11568915 CTAGGATGGGGATGAGGCCCGGG - Intronic
950297649 3:11846093-11846115 ATTGGTTTGGGATGAGGCCTGGG - Intronic
950541634 3:13616649-13616671 GTGGGGTGGGAAGGAGGCCCTGG + Intronic
950548143 3:13651029-13651051 CTGGGTTAAGAAGGAAGCCCAGG + Intergenic
951185567 3:19708745-19708767 CTGGGTTTGCCATGTTGCCCAGG - Intergenic
951509731 3:23487242-23487264 CTGGGATTGGGAAGAGGCCAGGG + Intronic
952081044 3:29757567-29757589 ATTGTTTTGGCATGAGGCCCAGG - Intronic
952409501 3:33034480-33034502 CTGGGTTTGAGATGTGGCCTGGG + Intronic
952722298 3:36545986-36546008 CTAGGTTTGGAATGAGGCCCAGG - Intronic
952913583 3:38212081-38212103 ATTGGTTTGGAATGAGGCCTTGG + Intronic
953109329 3:39918492-39918514 CAGGATGGGGAATGAGGCCCAGG - Intronic
956723592 3:72138969-72138991 CTGGGTTTGGAGAGAGGGGCAGG - Intergenic
956740740 3:72273817-72273839 CTGGGTCTGTAATAGGGCCCTGG - Intergenic
956909356 3:73801416-73801438 GTTGGCTTGGAATGGGGCCCAGG + Intergenic
958000306 3:87741137-87741159 CTGGGCTTGGAATGCAGCACAGG + Intergenic
958459506 3:94377035-94377057 CTGGGATTGAAATGAGGCCTTGG + Intergenic
960576726 3:119237495-119237517 TTGGCTTTGGAGTGGGGCCCAGG - Intronic
960675703 3:120192799-120192821 CAGGGTTTGGAATGAGAAACAGG + Intronic
961323290 3:126093382-126093404 CCTGGTTTGGAATGGGGCCCAGG - Intronic
963850653 3:150207411-150207433 CTGGGTTGGGGATGAGGGCAGGG - Intergenic
964570188 3:158102610-158102632 CTGGGGTTGGAAAGAGGCTTGGG - Intronic
966418479 3:179714354-179714376 CAGGGTTTGGAATCAGGGCACGG + Intronic
966968278 3:185017811-185017833 CCCGGTTTGGAATGGGGCCCAGG + Intronic
967050538 3:185779628-185779650 GTAAGTTTGGAATGAGGCCTGGG - Intronic
968699591 4:2048232-2048254 CTGGGCTTTGAATGGGGGCCTGG - Intergenic
969615651 4:8251196-8251218 TGGGGTTTGGAAGGAGGCCTCGG + Intergenic
970315870 4:14827848-14827870 CTGGGTTTGGAATGGGAACTGGG - Intergenic
971276759 4:25205711-25205733 CTGGGTTCTGACTGAGCCCCAGG + Intronic
971486363 4:27164542-27164564 CTGGGCTTGGTCTGAAGCCCTGG + Intergenic
971757326 4:30720872-30720894 CTGGGTTTGGAGTGAGTGCCTGG + Exonic
972080339 4:35141706-35141728 CCAGGTTTGGAACGGGGCCCAGG - Intergenic
972457678 4:39270257-39270279 CTTTGTGTGGAATGAGGCACGGG + Intronic
973008572 4:45044015-45044037 CCCTGTTTGGAATGGGGCCCAGG - Intergenic
973832298 4:54773897-54773919 CTGGGTTTGAATTCAGGCTCTGG + Intergenic
974057404 4:56997853-56997875 ATGGGAGTGGAATGGGGCCCAGG + Intronic
974566187 4:63580430-63580452 ATGGGATTGGAAGGAGGTCCTGG - Intergenic
974635977 4:64564562-64564584 CCCAGTTTGGAATGGGGCCCGGG - Intergenic
975289327 4:72658543-72658565 CTGGGTTTGGAAGAAGGGACTGG + Intergenic
975352206 4:73359106-73359128 CCCCGTTTGGAATGGGGCCCAGG - Intergenic
976641152 4:87339763-87339785 CTTGGTTTGGAGTGTGGCCTGGG - Intronic
976977797 4:91185591-91185613 CCAGGTTTAGAATGGGGCCCAGG + Intronic
977120736 4:93097529-93097551 ATGGTTTTGGAATGAGGCCCAGG - Intronic
977198081 4:94085662-94085684 CTGGTTCTGGAATGAGACTCGGG + Intergenic
977652899 4:99490319-99490341 CCTGGTTTGGAATGGGGCCCGGG + Intergenic
979361848 4:119774520-119774542 GTGGGTTTGGAATGGGACCTTGG + Intergenic
979758903 4:124374768-124374790 CTGGGTTTGGAAAGAAGCCAAGG - Intergenic
984292526 4:177813405-177813427 GGTGGTTTGAAATGAGGCCCAGG - Intronic
984491353 4:180438537-180438559 GTGGGTGTGGATTGGGGCCCAGG - Intergenic
985818174 5:2142005-2142027 CGGGGCTGGGAATGAGGCACGGG + Intergenic
987128720 5:14840746-14840768 CTGGCTTTCTAATGATGCCCAGG + Intronic
987668612 5:20979083-20979105 CTAGGTTTGGAAGGAGGGCTCGG + Intergenic
988811100 5:34786123-34786145 CCCGGTTTGGAACGGGGCCCGGG + Intronic
989758761 5:44987528-44987550 CGTGGTTTGGAATGGGGCCTGGG - Intergenic
992024865 5:72660054-72660076 GTTGGTTTGAGATGAGGCCCAGG - Intergenic
992363720 5:76070109-76070131 CTGGGTGTGGGCTGGGGCCCTGG - Intergenic
992577587 5:78133629-78133651 CTGGTTTTGGATTGAGCCTCTGG - Intronic
993604995 5:89978970-89978992 ATGGGTTTGGATTGAAGCCAGGG + Intergenic
993903292 5:93598465-93598487 CTGGGGTTGGAATGCTCCCCAGG + Intergenic
993984186 5:94577504-94577526 CTAGGTCTGGGATGGGGCCCAGG - Intronic
994750693 5:103733635-103733657 AAGGCTTTGGCATGAGGCCCTGG + Intergenic
995711551 5:115041083-115041105 CCCGGTTTGGAATGGGGCCTGGG + Intergenic
997446283 5:133942791-133942813 CTGGATTTGGGATGAGGCCTGGG + Intergenic
997774900 5:136594598-136594620 CTGGGTGCTGAATGAGGTCCAGG + Intergenic
998527860 5:142858996-142859018 CTGGGTATGGAGTGAGGGCAAGG + Intronic
1000012759 5:157248047-157248069 CTGGGTTTGGGCTAGGGCCCAGG + Intronic
1000365488 5:160486773-160486795 CTGGTTCTGGAATGAGTCACTGG - Intergenic
1001223160 5:169920579-169920601 ATGGGTTTGGAAAGAGGGCATGG + Intronic
1001812741 5:174642147-174642169 CTGAGTCTGGAAGGATGCCCAGG + Intergenic
1003563558 6:7203558-7203580 CTGGGTTTGGAGAGAAGCTCTGG + Intronic
1004360475 6:14966415-14966437 CTAGGTCTGGGATAAGGCCCAGG - Intergenic
1005858233 6:29880521-29880543 CCTGGTTTAGAATGGGGCCCGGG + Intergenic
1005927215 6:30453557-30453579 GTGTTTTTGGAATGAGGCCTTGG - Intergenic
1005930738 6:30481962-30481984 GTGTTTTTGGAATGAGGCCTTGG - Intergenic
1006038559 6:31234096-31234118 CCCGGTTTGGAATGGGGCCCCGG + Intergenic
1006387669 6:33740421-33740443 CTGGTTGTTAAATGAGGCCCTGG + Intronic
1007326076 6:41060943-41060965 ATTGGTTTGGCATGAGGCCCAGG + Intronic
1007527135 6:42506208-42506230 CGGGGTATGGACTGAGGCACTGG + Intergenic
1007658802 6:43469479-43469501 CTGGGTTTGGATTTCAGCCCTGG - Intergenic
1009299025 6:61991443-61991465 TTGAGTTTGGAATAGGGCCCAGG + Intronic
1009510048 6:64539613-64539635 CTGGGTCTGGGATGAGCCCAAGG + Intronic
1009598194 6:65763511-65763533 CTGGTTTTGGAATGACTCCCTGG + Intergenic
1009955457 6:70447634-70447656 CCTGGTTTGGAATGGGGCCCAGG + Intronic
1010454427 6:76038715-76038737 CTGGGGTGGGAGTGAGGCCAAGG - Intronic
1010540748 6:77089133-77089155 CTGGCTTTGGAATGAGGCCCAGG - Intergenic
1010802908 6:80198932-80198954 CTGGTTCTGCAAAGAGGCCCTGG + Intronic
1013519310 6:110917973-110917995 CCCGGTTTGGAACGGGGCCCAGG - Intergenic
1016339716 6:143049650-143049672 CCGGGTTGGGACTGAGCCCCAGG - Intergenic
1016451686 6:144189211-144189233 CAGGGTTTGCCATGTGGCCCAGG + Intergenic
1016823748 6:148369261-148369283 CTGGGTTTGTCATGAGTCTCTGG + Intronic
1016990268 6:149923555-149923577 CGGGATTTGGGATGAGGCCGCGG - Intergenic
1017916849 6:158837662-158837684 GTGGTTTTGGAATGAGACCTGGG + Intergenic
1018435199 6:163752844-163752866 GGGGGTTTGGAATGGGTCCCTGG + Intergenic
1018594103 6:165460039-165460061 CCCGGTTTAGAATGGGGCCCGGG - Intronic
1018838874 6:167505125-167505147 GTGGGTCTGGAGTGAGGCCCAGG + Intergenic
1019290766 7:248954-248976 CCGGGTGTGGAAGGAGGCACAGG - Intronic
1019448055 7:1081614-1081636 CTGTGTATGGCATGAGGTCCTGG - Intronic
1021038863 7:15836203-15836225 GTAGGTCTGGAATGCGGCCCAGG - Intergenic
1022205310 7:28158241-28158263 ATGGGTTTTGGGTGAGGCCCAGG - Intronic
1025926714 7:65966384-65966406 CTGGGGTGGGAATGAGGGGCTGG + Intronic
1026367891 7:69667764-69667786 CTGGATTGGGAATGGGCCCCAGG - Intronic
1026507946 7:71002720-71002742 CAGGGTGTGGGTTGAGGCCCAGG - Intergenic
1027131429 7:75593928-75593950 GTGTGTTTGGAATTAGGCCTGGG - Intronic
1027131512 7:75594422-75594444 GTGTGTTTGGAATCAGGCCTGGG - Intronic
1027464382 7:78496860-78496882 CAGGGTTTAGAATGATTCCCAGG + Intronic
1029031437 7:97471625-97471647 CGGGGGTTGGAATGAGGACCTGG - Intergenic
1031528185 7:122846924-122846946 GTAGGTTTGGTATGAGGCCTAGG - Intronic
1032538432 7:132683910-132683932 CTGGGATGGGAAGGAGGCACCGG - Intronic
1033127088 7:138715806-138715828 CTGTGTTTGAAATGCAGCCCAGG + Exonic
1033276672 7:139976704-139976726 GTGGGTCTGGAGTGAGGCCTGGG + Intronic
1033630528 7:143153270-143153292 CTGGGTTAAGCATTAGGCCCAGG - Intergenic
1034415757 7:150963562-150963584 CTGGGGTGGGAATGGGGCCAGGG - Intronic
1034448183 7:151123913-151123935 CAGGGCTCAGAATGAGGCCCAGG + Intronic
1035371080 7:158379255-158379277 CTGGGGTTGGCAGGAGGACCGGG + Intronic
1036037206 8:5032321-5032343 CAGGGTTTGGGATGAGGCACGGG - Intergenic
1036487412 8:9192016-9192038 GTGGGTCTGGGATGGGGCCCAGG + Intergenic
1036707901 8:11059075-11059097 CTGGGATTGGATTCAGGCACAGG - Intronic
1036758312 8:11486568-11486590 CTGGGTTTGGCACAAGGTCCAGG - Intergenic
1036971482 8:13360321-13360343 GTTGGTTTGCAGTGAGGCCCTGG - Intronic
1037504455 8:19516403-19516425 CTGGGTGTAGAATGAGGAGCAGG - Intronic
1037991901 8:23327326-23327348 CTGGATGTGGTGTGAGGCCCTGG + Intronic
1039691803 8:39872358-39872380 CCTGGTTTGGAAAGGGGCCCAGG - Intergenic
1039915691 8:41858862-41858884 CTGTGTTTGGAATGGGGCTGAGG + Intronic
1040799564 8:51325678-51325700 CTGGGTTAGGACGGAAGCCCAGG + Intronic
1040915467 8:52563869-52563891 CTGGGTGTGGAAGGAGGCGCTGG - Intronic
1040956254 8:52982956-52982978 CCCGGTTTGGAATGGGGCCTGGG + Intergenic
1041067105 8:54092416-54092438 GTGGGTCTGGAATGAGACCAAGG - Intronic
1041650733 8:60299701-60299723 CTGGGTCTGGAATGGAGCCCAGG - Intergenic
1041705414 8:60841453-60841475 CTTGGTTTGGTCTCAGGCCCTGG + Intronic
1046938574 8:119908964-119908986 ATGGTTTTTAAATGAGGCCCTGG - Intronic
1048546275 8:135390460-135390482 AGGAGTTGGGAATGAGGCCCTGG - Intergenic
1049302351 8:141878339-141878361 CTGAGTGGGGAATCAGGCCCAGG + Intergenic
1049531902 8:143159288-143159310 CTGGATTTGAAAGGAGGCCCGGG + Intronic
1051590099 9:18769025-18769047 ATGGGTCTGAAGTGAGGCCCAGG + Intronic
1051793759 9:20839450-20839472 CTGGGTTTGCCATGTTGCCCAGG + Intronic
1051920453 9:22258069-22258091 CTGGGTCTGGACTGAGACCCTGG + Intergenic
1054761977 9:69012384-69012406 CTGACTTTGGAAGGAGGCTCTGG - Intergenic
1056713209 9:89008472-89008494 CTAGGTCTGGAGTGGGGCCCGGG - Intergenic
1056790856 9:89624476-89624498 CTGGGTTTGTCCCGAGGCCCCGG + Intergenic
1057438688 9:95065521-95065543 CTGGCTTAGTAATGAGGCCCTGG - Intronic
1058903004 9:109458246-109458268 CTGGGTTTGGGAGGAGGACAGGG + Intronic
1059716440 9:116917583-116917605 GAGGGTTTGGGATGAGGCCTGGG - Intronic
1060495456 9:124115168-124115190 TTGGGGTTGGGATCAGGCCCAGG - Intergenic
1060549937 9:124480132-124480154 TTGGGTTTTGAAGGATGCCCAGG - Intergenic
1061093068 9:128437641-128437663 CTGGGTTTTGCATGTTGCCCAGG + Intergenic
1061487484 9:130927643-130927665 GGGGGTTGGGGATGAGGCCCAGG + Intronic
1061927560 9:133813394-133813416 CGAGGTTTGGGATGAGGCCGTGG - Intronic
1062168007 9:135118039-135118061 CTGGGTTTGGAGGGAGGACATGG + Intronic
1062244207 9:135555607-135555629 CAGGGTTTGCAATGAGGCTGTGG - Intergenic
1188993624 X:36854860-36854882 ATTGGTTTGGAGTGTGGCCCGGG + Intergenic
1190054847 X:47175457-47175479 CTGAGGGTGGAATGAGGTCCTGG - Intronic
1191580702 X:62757749-62757771 CTTGGTTTGGAATGCGGCCCAGG + Intergenic
1192167295 X:68834039-68834061 TGGGGTTTGGGAAGAGGCCCTGG + Intronic
1192203472 X:69081734-69081756 CTGGGATAAGAATGAGGACCTGG - Intergenic
1192884702 X:75324302-75324324 CTCGGTTTGGAACGGGGCCAGGG - Intergenic
1194536108 X:95107287-95107309 CCCAGTTTGGAATGGGGCCCAGG + Intergenic
1195143074 X:101983579-101983601 ATGGGTTTGTGATGAGGCCTAGG + Intergenic
1196633382 X:117970080-117970102 CTGGGTTTAGAAAGAGACCATGG + Intronic
1196861471 X:120032881-120032903 TTGGCTTTGGAATTAGGCCATGG + Intergenic
1197135306 X:123053217-123053239 CTGGGTTTTGAATGAGATCTTGG + Intergenic
1197181230 X:123539171-123539193 CTGGGTTGGGCATGGAGCCCGGG + Intergenic
1197723920 X:129762991-129763013 CTTGGTCTGGAATGGGGCCTGGG - Intronic
1198633505 X:138669475-138669497 CTGGGTTTAGCATCAGGCACAGG - Intronic