ID: 1168994694

View in Genome Browser
Species Human (GRCh38)
Location 20:2124434-2124456
Sequence CCAAAGGGAGGATGGGAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 719
Summary {0: 1, 1: 0, 2: 4, 3: 66, 4: 648}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168994679_1168994694 23 Left 1168994679 20:2124388-2124410 CCCAGAAGCTGATCCCTACTTAG 0: 1
1: 0
2: 1
3: 7
4: 87
Right 1168994694 20:2124434-2124456 CCAAAGGGAGGATGGGAAAAGGG 0: 1
1: 0
2: 4
3: 66
4: 648
1168994680_1168994694 22 Left 1168994680 20:2124389-2124411 CCAGAAGCTGATCCCTACTTAGT 0: 1
1: 0
2: 1
3: 5
4: 73
Right 1168994694 20:2124434-2124456 CCAAAGGGAGGATGGGAAAAGGG 0: 1
1: 0
2: 4
3: 66
4: 648
1168994683_1168994694 10 Left 1168994683 20:2124401-2124423 CCCTACTTAGTCTTTGGTGGAGC 0: 1
1: 0
2: 0
3: 5
4: 94
Right 1168994694 20:2124434-2124456 CCAAAGGGAGGATGGGAAAAGGG 0: 1
1: 0
2: 4
3: 66
4: 648
1168994684_1168994694 9 Left 1168994684 20:2124402-2124424 CCTACTTAGTCTTTGGTGGAGCC 0: 1
1: 0
2: 0
3: 1
4: 88
Right 1168994694 20:2124434-2124456 CCAAAGGGAGGATGGGAAAAGGG 0: 1
1: 0
2: 4
3: 66
4: 648
1168994678_1168994694 24 Left 1168994678 20:2124387-2124409 CCCCAGAAGCTGATCCCTACTTA 0: 1
1: 0
2: 0
3: 8
4: 93
Right 1168994694 20:2124434-2124456 CCAAAGGGAGGATGGGAAAAGGG 0: 1
1: 0
2: 4
3: 66
4: 648

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168994694 Original CRISPR CCAAAGGGAGGATGGGAAAA GGG Intronic
900355223 1:2258354-2258376 CCCTAGGGAGGATGGGACAGTGG + Intronic
900466424 1:2827738-2827760 AAGAAGGGAGGATGGGAGAAGGG + Intergenic
900513949 1:3072643-3072665 CCCCAGGGAGGGTGGGAGAAGGG - Intronic
901162425 1:7189090-7189112 CCAAAGAGAGGATGGGATTCAGG - Intronic
901930827 1:12595474-12595496 CCAAGCGGCGGATGGGAAAGGGG + Intronic
902039421 1:13482135-13482157 CAAAAGGAAGGAAGGGAAGATGG + Intronic
902060727 1:13640384-13640406 CCAAAAGCAGGAGGGTAAAAGGG + Intergenic
902227150 1:15003661-15003683 TGAAAGGGAGCTTGGGAAAAGGG + Intronic
902854312 1:19189187-19189209 TCAAAGAGAGCATGGGGAAATGG + Intronic
903076508 1:20772365-20772387 TCATAGTGAGGATGGAAAAAGGG - Intronic
903187317 1:21635906-21635928 CGAATGGGAGGATGAGAAACTGG + Intronic
903332970 1:22606363-22606385 CCATGGGGAGGATGGGGAAGTGG + Intergenic
903790375 1:25888839-25888861 GAAAAAGGAGGATGGGAAAAGGG + Intronic
903886799 1:26545653-26545675 CCACAGGGAGGATGGGGGAACGG + Intronic
904825135 1:33269371-33269393 CCAGAGGGAGGCTGGGAGCAAGG - Intronic
905144515 1:35877383-35877405 GCAAAGGAAAGATGGGAGAAAGG - Intronic
905508136 1:38496401-38496423 GCAAAGGGAGGGTGGGAAGAGGG - Intergenic
906040806 1:42786460-42786482 CCAAAGGGAGGTTCTGAGAAGGG + Intronic
906081017 1:43088357-43088379 ACAAGGGGAGGATGTGAAAGAGG - Intergenic
906183106 1:43838489-43838511 CCAGAGGCAGGATGGGAGTAAGG - Intronic
906665822 1:47621342-47621364 CCTCAGGGAGGAAGGCAAAAGGG - Intergenic
906884750 1:49632207-49632229 CCAGAGGGAGTCTGGGAATATGG + Intronic
907208911 1:52801115-52801137 TGAAAGGGAGGAAGGGGAAAAGG + Intronic
907307562 1:53521792-53521814 CCAGAGCCAGGATGGGAACAGGG + Intronic
907315905 1:53572483-53572505 CCAAAGGGAGGTGGGCAAACAGG - Intronic
907787361 1:57625731-57625753 GGAAAGGGAGGAGGGGAAAAAGG + Intronic
907945572 1:59133352-59133374 AGAAAGGGAGGAAGGGAAGAGGG + Intergenic
908658869 1:66417255-66417277 TCACAGGGAGGATTGAAAAAAGG - Intergenic
909358887 1:74739924-74739946 CCAGAGGGAGGAGGAGAAAGAGG + Intronic
910078547 1:83310460-83310482 TGAAAGGGAGGATGGAATAAGGG + Intergenic
910285291 1:85547059-85547081 CCTCTGAGAGGATGGGAAAAAGG - Intronic
910946702 1:92600573-92600595 CCATAGAGAGGGTGGGAGAATGG + Intronic
911203028 1:95065598-95065620 ACGAAAGCAGGATGGGAAAAGGG + Intronic
911379636 1:97096700-97096722 TCACAGGGAGGATTGAAAAAAGG + Intronic
912382670 1:109255741-109255763 GCAAAGGCAGGATGGGAACAGGG - Intronic
912459114 1:109819456-109819478 CCACAGGGAAGATGGGAGACAGG - Intergenic
912764228 1:112394366-112394388 CGAAAGGGAGGAGGAGGAAATGG + Intergenic
913015517 1:114729977-114729999 ACAATGGGAGGCAGGGAAAAGGG + Intronic
913383346 1:118233143-118233165 TCACAGGGAGGATTGTAAAAAGG + Intergenic
914724437 1:150315914-150315936 CCAGAGGGAGGAAGGGAGGAAGG - Intergenic
914764311 1:150624511-150624533 CCAGAGGTAGGCTGGGAAAGTGG + Intronic
915144517 1:153787993-153788015 CTAAAGGGAAGATGGATAAAGGG + Intergenic
915974329 1:160375111-160375133 AGATAGGGAGGATGGGGAAAAGG + Intergenic
916116121 1:161486498-161486520 CCAAAGGAAGGAGGGAACAAAGG - Intergenic
916328964 1:163593866-163593888 ACAAGGGGAGGATGTGAAGAAGG - Intergenic
917489853 1:175488821-175488843 CCGAAGGGTGGATGGGGCAAGGG + Intronic
918986399 1:191633394-191633416 CCAAAGGAAAAATGGGTAAATGG + Intergenic
919294951 1:195685983-195686005 CCACAGGGATGATGGCAAGACGG + Intergenic
920042868 1:203114540-203114562 GAAAAGGGAGGAAGGGAAGAAGG - Intronic
920204965 1:204284529-204284551 CCAAAGGGAGCCTAGGAACAAGG + Intronic
920257375 1:204664805-204664827 CCAGAGGGAGAATGGGCACAAGG - Intronic
920890741 1:209983301-209983323 CCAAAAGGAGAAGAGGAAAAAGG - Intronic
920908176 1:210190555-210190577 GCAAAGAGAGGTTGGGACAAGGG - Intergenic
921122989 1:212152888-212152910 GGAATGGGAGGATGGGAATAGGG + Intergenic
921141021 1:212306316-212306338 ACAAAGGCAAGAAGGGAAAAGGG + Intronic
921153008 1:212416579-212416601 GAAAGAGGAGGATGGGAAAATGG - Intergenic
921382536 1:214539648-214539670 CCAAAGGAAGGAAGGGAAGAAGG + Intronic
921778840 1:219135723-219135745 TCAAAGGGAGATTGGCAAAATGG + Intergenic
921815191 1:219555539-219555561 CCAAAGGGAGGAGAGGAATTTGG + Intergenic
921901260 1:220453472-220453494 CCACAGGGAAGAAGGGGAAAAGG - Intergenic
922434293 1:225588186-225588208 AGAGAGGGAGGAGGGGAAAAGGG + Intronic
922969941 1:229727762-229727784 CCAGACGGAGGAGGGGAAAGGGG + Intergenic
923210513 1:231799908-231799930 AGAAAGGGAGGAAGGGAAGAAGG - Intronic
923285541 1:232491432-232491454 AGAAAGGGAGGATGGAAGAAGGG - Intronic
923657480 1:235930688-235930710 CCAAAGGGAGGAGGGTAAATGGG + Intergenic
924860770 1:247919525-247919547 ACTAAGGAAGGTTGGGAAAACGG + Intergenic
1063357045 10:5410928-5410950 TCACAGGGAGGATTGAAAAAAGG - Intergenic
1064504705 10:16015833-16015855 AGAGAGGGAGGATGGGAAAGAGG + Intergenic
1064588666 10:16865681-16865703 TCACAGGGAGGATTGAAAAAAGG + Intronic
1064598857 10:16973204-16973226 GCAAGGGAAGGATGGGGAAATGG - Intronic
1065639868 10:27770696-27770718 ACAAAGGAAGGAAGGAAAAAAGG - Intergenic
1065659779 10:27993802-27993824 CCAAAGGGAGAAAAGGGAAAAGG + Intronic
1067531654 10:47078522-47078544 TCACAGGGAGGATTGAAAAAAGG - Intergenic
1068040595 10:51819306-51819328 CCCTGGGCAGGATGGGAAAAGGG - Intronic
1068091008 10:52432043-52432065 CCAGAGGGAGGAGGAGGAAAGGG - Intergenic
1069152708 10:64985015-64985037 TCACAGGGAGGATTGAAAAAAGG - Intergenic
1069200470 10:65608726-65608748 CCAAAAGGAGGAAGGGGAAAGGG + Intergenic
1069231241 10:66011224-66011246 CAAGAGGGAGGAAGAGAAAAGGG - Intronic
1070392026 10:75979652-75979674 CCAAACAGAGAAGGGGAAAAGGG - Intronic
1070954097 10:80453697-80453719 TCAAAAGAAGGATGGGGAAAAGG - Intergenic
1071037878 10:81269090-81269112 TCACAGGGAGGATTGAAAAAAGG + Intergenic
1073121990 10:101127578-101127600 AAAAAGGTAGGAGGGGAAAAAGG + Intronic
1073269169 10:102247242-102247264 ACGAAGGTAGGAAGGGAAAAGGG - Intronic
1073541622 10:104319861-104319883 CCAGAGGGAGGAGGGTATAATGG - Intronic
1074238758 10:111614180-111614202 GCAAAGGGAAGATGGTTAAAGGG + Intergenic
1074495633 10:113977928-113977950 CCAGAGAAAGGATGGGAAAGGGG - Intergenic
1075353182 10:121744780-121744802 CCACAGGAAGGCTGGGAAACAGG - Intronic
1075497265 10:122934129-122934151 CCATTGGGAGGATTGGATAAAGG - Intronic
1075581148 10:123619548-123619570 GAAAAGGGAGGAGGGGAGAAGGG + Intergenic
1075947794 10:126453346-126453368 CCAAAGTGAAGAAGGGAAGAAGG + Intronic
1076499284 10:130923697-130923719 CCCAAGGGTGGATGGGGAAGGGG - Intergenic
1076529517 10:131135296-131135318 CCCAAGGCTGGATGGGAAGATGG - Intronic
1077850627 11:6072266-6072288 GCAAAGAGAGGCTGGGAAGAGGG + Intergenic
1077905727 11:6531592-6531614 CCAAAGGGACAGTGTGAAAAAGG + Intronic
1077965954 11:7133788-7133810 AAAAAGGGAGGATGGGCCAAAGG - Intergenic
1078677337 11:13434689-13434711 ACAATGGGAGAATGGGAGAAAGG + Intronic
1078789162 11:14525738-14525760 GCAAAGAGAGGCTGGGACAAGGG - Intronic
1079484486 11:20920897-20920919 CCAAAGGGAGGTTTAGAAGATGG - Intronic
1080016614 11:27513612-27513634 CTAAAGGGAAGCTAGGAAAATGG + Intergenic
1080135037 11:28844616-28844638 AGAAAGGGAGGAAGGGAAGAAGG - Intergenic
1080798353 11:35586828-35586850 CCAAAGGGAGGATGGGTAGAGGG + Intergenic
1081600087 11:44486940-44486962 CCCAAGCGAGGATGGGGCAAAGG - Intergenic
1082632705 11:55560354-55560376 ACAAAGGGAGGATGTGAAAGAGG - Intergenic
1083859590 11:65412714-65412736 CCAAAGGGAGGAGGGTGAACAGG - Exonic
1084333817 11:68445720-68445742 ACAAAGGGAGGAAGGGACCAGGG - Intronic
1084351837 11:68607214-68607236 CAAAAGGGAAGATTGAAAAAGGG + Intronic
1084613109 11:70216747-70216769 GCAAAGGGAGGCTGGGATGAAGG + Intergenic
1084895047 11:72260145-72260167 CTAAAGAAATGATGGGAAAATGG - Intergenic
1085220661 11:74871348-74871370 CTAAAGGAAGGAGGGGAATAAGG + Intronic
1085396018 11:76207567-76207589 GGAAGGGGAGGATGGGAAACGGG + Intronic
1085756255 11:79204070-79204092 CCAAAGCAGGGATGGGAATAAGG + Intronic
1085954339 11:81372760-81372782 CCAAAGGGATGTTGGAAATATGG + Intergenic
1086134730 11:83434467-83434489 TCAAGGGGAGGATGTGAAGAAGG + Intergenic
1086276191 11:85132751-85132773 ACAAAGGTAGGATAGGAAACAGG - Intronic
1086365014 11:86100412-86100434 AGGAAGGGAGGAAGGGAAAAAGG - Intergenic
1086868397 11:92007675-92007697 ACTAAGGGATGATGAGAAAATGG + Intergenic
1087048180 11:93861871-93861893 CCAAAGTGAGGATGGGGCAGGGG + Intergenic
1088528559 11:110784198-110784220 ACATAGGGATTATGGGAAAATGG + Intergenic
1088973659 11:114795549-114795571 CCAAAGCAAGGATGGGCAACAGG - Intergenic
1089298911 11:117486211-117486233 CAAAATGGCGGATGGGAAAGTGG + Intronic
1089401728 11:118168365-118168387 GAAAAGGGTGGATGGGAAGAGGG - Intronic
1089633380 11:119797101-119797123 CTAAAGAGAGGATGGGGAATGGG - Intergenic
1089647467 11:119889679-119889701 CCAGAGGGAGGATGGGTATGGGG - Intergenic
1089841362 11:121420911-121420933 CCAAAGGCAATATGGAAAAATGG + Intergenic
1090190022 11:124761403-124761425 CCAAAGGGAAGAGGGGAAATTGG - Intronic
1090254420 11:125273355-125273377 GCAAAAGGAGGATGGGCAGATGG + Intronic
1090365927 11:126205570-126205592 CCGCATGGACGATGGGAAAATGG - Exonic
1090988622 11:131795959-131795981 CAGATGGGAGGAAGGGAAAAAGG + Intronic
1091016121 11:132052282-132052304 TAAAAAGGAGGAAGGGAAAAAGG - Intronic
1091193897 11:133715991-133716013 CCAAAGGGAGGAGGAAAGAAAGG + Intergenic
1091554192 12:1559897-1559919 CCAATGGGAGGCTGGGGAGAAGG - Intronic
1092119332 12:6033260-6033282 CCCAAAGGAGGATGGCAGAAAGG + Intronic
1093475382 12:19548938-19548960 CTAAAAGGAGGAAGGGAAGAAGG - Intronic
1093648554 12:21617192-21617214 AGAAAGGGAGGATGGGAGGAAGG - Intergenic
1093797615 12:23331869-23331891 CCAAAGGGAGAATGTAAACAAGG + Intergenic
1093951178 12:25165996-25166018 ACAAAGGGAGGATGTGAAGGAGG - Intronic
1095174713 12:39078310-39078332 ACAAAGGAAGGAAGGGAGAAAGG + Intergenic
1095284434 12:40391309-40391331 AGAAAGGGATGATGGGAAAGAGG + Intergenic
1096876298 12:54632944-54632966 CAATAGGGAGCATGGGGAAAAGG - Intronic
1096880568 12:54665706-54665728 CCAAAGGAAGGAAGAGAATAAGG - Intergenic
1097008747 12:55937685-55937707 CTAAAGGGAGGAAAGGTAAAGGG + Intronic
1097275119 12:57807830-57807852 CCAGAGGGAGAAAGGGAACATGG - Intronic
1097517672 12:60625237-60625259 CCAAAGGAAGGAGGGCATAAAGG + Intergenic
1097709962 12:62907456-62907478 CCAAAGGCAGCATGGGACAGTGG - Intronic
1098227652 12:68341116-68341138 CCAAAGGAAGGATGGGAATTGGG + Intergenic
1099375950 12:81896665-81896687 TCACAGGGAGGATTGAAAAAAGG + Intergenic
1099543078 12:83939345-83939367 CCAAAGAGAGAATTGAAAAAAGG + Intergenic
1100391782 12:94150236-94150258 CCAAAGGGAGAGTGTAAAAAGGG + Intronic
1100615350 12:96227331-96227353 CAGAAGAGATGATGGGAAAAAGG - Intronic
1100882215 12:99031609-99031631 CCAGATGGAGGAAGGGGAAAGGG - Intronic
1100971512 12:100075949-100075971 CCAAAAGGAGGATGGGAGGAAGG + Intronic
1101091715 12:101293856-101293878 CCAAAGGGAACACGGGAGAAAGG - Intronic
1101278224 12:103225107-103225129 GCAAAGAGAGGCTGGGACAAGGG + Intergenic
1101523800 12:105508956-105508978 CCAAGGGGAGAAAGGGAGAATGG - Intergenic
1101723497 12:107371008-107371030 CCAAAGGGAGGAGGAGAAGGGGG - Intronic
1102433429 12:112901375-112901397 CAAAAGGGAGGCCAGGAAAAGGG + Intergenic
1102717402 12:114986278-114986300 AGAAAGGGAGGAAGGGAAAGGGG - Intergenic
1102887095 12:116530440-116530462 CCAGTGGGAGGATGGGAAGGAGG + Intergenic
1103246684 12:119464048-119464070 GCAGAGGAAGGAAGGGAAAATGG - Intronic
1103989416 12:124788483-124788505 TGAAAGGGAGGAGGGAAAAAAGG - Intronic
1104536803 12:129625174-129625196 CCAAAAGGAAAATGGGTAAAAGG - Intronic
1105031730 12:132888663-132888685 CCAAAGGGAGGACAGTATAATGG - Intronic
1105599820 13:21876694-21876716 TCACAGGGAGAATTGGAAAAAGG - Intergenic
1105644370 13:22301661-22301683 ACAAAGGAAGGAAGGAAAAAAGG - Intergenic
1106116782 13:26824551-26824573 CGAAAGGGAGGAAGAGAAGAAGG - Intergenic
1106469591 13:30042599-30042621 TCAAAGGCAGTTTGGGAAAAGGG - Intergenic
1106883180 13:34153784-34153806 ACAAAGGCAGAAAGGGAAAAAGG + Intergenic
1107638200 13:42414518-42414540 CCAAAGGCAGGAGGAGCAAAAGG + Intergenic
1107698029 13:43019869-43019891 GCAAAGAAAGGATGGAAAAAAGG - Intergenic
1107790430 13:43996628-43996650 CCAAAGGGTGGCTGATAAAAAGG + Intergenic
1108904380 13:55450757-55450779 CCATTGGGTGGCTGGGAAAAGGG - Intergenic
1108919376 13:55657404-55657426 GCAAAGAGAGGATGGGACGAGGG + Intergenic
1109343749 13:61091638-61091660 GCAAAGAGAGGCTGGGACAAGGG - Intergenic
1109402199 13:61848210-61848232 ACAAAGGGAGTGTGGGAAATAGG - Intergenic
1109442877 13:62398050-62398072 CCAAAGGAAGGAGGGTATAATGG - Intergenic
1110120185 13:71870186-71870208 GGGAAGGGAGGACGGGAAAAAGG - Intergenic
1110531912 13:76607685-76607707 GCAAAGGGAGGATGATAAACAGG - Intergenic
1112149713 13:96744898-96744920 CCAAAGGAACAAAGGGAAAATGG + Intronic
1112264769 13:97913227-97913249 CCAGTGGGAGGATGGGAAAGAGG + Intergenic
1112601061 13:100856462-100856484 CCAATGGGTGGATGGGGGAATGG + Intergenic
1112721424 13:102250235-102250257 CCAAAGGGAGGAAGTGCACAAGG + Intronic
1113608455 13:111626780-111626802 GCAAAGGCAGGAGGGGAAGAGGG + Intronic
1113670278 13:112171275-112171297 CCAGAGCCAGGGTGGGAAAAAGG + Intergenic
1114378277 14:22173086-22173108 CGAAAGAAAGGATGGGAAAAGGG + Intergenic
1114412243 14:22512105-22512127 CCCAAAGGAGGAAGAGAAAATGG + Intergenic
1114546992 14:23510302-23510324 CCTAAGTGAGGACAGGAAAAGGG + Intergenic
1114592475 14:23879586-23879608 CCAAAGTAAGAATGGGCAAACGG + Intergenic
1114754500 14:25244354-25244376 AGAAAGTGAGGAGGGGAAAATGG + Intergenic
1114773768 14:25458180-25458202 ACCAAGTGAGGATGGGACAAAGG - Intergenic
1115084089 14:29492719-29492741 CCAGAGGGAGAATGGGAGCAGGG - Intergenic
1115128263 14:30022697-30022719 ACAAAGGGAGGCTTAGAAAAAGG + Intronic
1115592508 14:34877323-34877345 CAAAAGGGGGATTGGGAAAATGG + Intergenic
1116140250 14:40984273-40984295 CCAAAGGGAGAATGGACAGATGG - Intergenic
1116534606 14:46014855-46014877 GCAAAGGGAGGCTGGGACAAGGG + Intergenic
1116817340 14:49596529-49596551 CAAAGGGGAGGATGTGGAAAGGG + Intronic
1117617274 14:57546412-57546434 GGAAAGGGAGGAAGGGAAGAGGG + Intergenic
1117726742 14:58682232-58682254 GCAAAGGGAGGGAGGGAAGATGG - Intergenic
1118070721 14:62244465-62244487 AGAAAGGGAGGAAGGAAAAAAGG - Intergenic
1118150028 14:63179373-63179395 CCAAAGGAAGGAGGAGAAAAAGG - Intergenic
1118160615 14:63286184-63286206 ACCAAGGGAGAAAGGGAAAATGG - Intronic
1118206423 14:63727809-63727831 CCGGAGGGAGGATGAGAAAGCGG - Exonic
1118380426 14:65213543-65213565 CCACAGGGAGGAGGGTATAATGG + Intergenic
1118941624 14:70344889-70344911 CCCAAGTGAGGATGGGACAAAGG - Intronic
1119120411 14:72070565-72070587 CCAAAGATAGGATGGCTAAAAGG - Intronic
1119206618 14:72799186-72799208 CCATAGGGAGGATGGGTTGATGG - Intronic
1119682972 14:76606707-76606729 CCATGGGGAGGATGGGAGAAAGG - Intergenic
1120299752 14:82691571-82691593 CCAGAGGTAGGCTGGGAAAGTGG + Intergenic
1120669598 14:87348697-87348719 TCAAAGGAAAGATGGGAATATGG - Intergenic
1120899775 14:89565656-89565678 CCAAAGGGGAGATGAAAAAAAGG + Intronic
1120912656 14:89681810-89681832 CAAGAGGGAGAGTGGGAAAAGGG - Intergenic
1121008072 14:90503005-90503027 AGAAAGGAAGGAAGGGAAAAGGG + Intergenic
1121166893 14:91810396-91810418 AGGAAGGGAGGATGGGAGAAAGG + Intronic
1121390530 14:93569659-93569681 CTTAAGGGAGGATGGGGGAATGG + Intronic
1122053483 14:99075998-99076020 CAGAAGGGAGAGTGGGAAAAGGG - Intergenic
1122170217 14:99867077-99867099 CCAAAAGGAGGGTGGGAGAGAGG - Intronic
1122986080 14:105212228-105212250 GGAAAGGGAAGATGGGCAAAAGG - Intronic
1123101998 14:105810247-105810269 CCAAAGGGAAGCAAGGAAAAAGG - Intergenic
1123905302 15:24914875-24914897 CCAAATAGATCATGGGAAAAAGG + Intronic
1123976830 15:25561585-25561607 ACAAAGGAAGGAAGGAAAAAAGG + Intergenic
1124337482 15:28868197-28868219 CCCAAGGAAGGATGGGAACGCGG - Intergenic
1124465661 15:29936951-29936973 CCATAGGTATGATGGGAAATTGG - Intronic
1126072368 15:44876166-44876188 TCACAGGGAGGATTGAAAAAAGG - Intergenic
1126530045 15:49701999-49702021 ACAAGGGGAGGATGTGAAGAAGG + Intergenic
1126552835 15:49952303-49952325 CCAGAAGGAGAAGGGGAAAATGG - Intronic
1126567218 15:50113058-50113080 CCAGAGGGAGGAAGGGGGAAGGG - Intronic
1126843920 15:52741860-52741882 GCAAAGAGAGGCTGGGACAAGGG - Intergenic
1127092095 15:55477475-55477497 CCAAAGGGAGGAGTAGAAAATGG + Intronic
1127730326 15:61795718-61795740 AGAAAGGGAGCATGTGAAAAGGG - Intergenic
1127834411 15:62778883-62778905 GCAAAGGGAGAATGGGAATGAGG - Intronic
1127901256 15:63342613-63342635 CAAAAGGGAGGAGGGTATAATGG + Intronic
1128241456 15:66104117-66104139 ACAAAGGGAGGGAGGGACAAAGG - Intronic
1128532609 15:68464904-68464926 CCAGAGGGAGGCTGGGGGAAGGG - Intergenic
1129781030 15:78271362-78271384 ACAAAGGGAGGGTGGGCAAGAGG - Intronic
1130781169 15:87042499-87042521 ACAAGGGGAGGATGTGAAAGAGG - Intergenic
1131881106 15:96863021-96863043 TCACAGGCAGGATGGGTAAATGG + Intergenic
1132344841 15:101101963-101101985 TCTAAGGGAGGATTGAAAAAAGG + Intergenic
1132912952 16:2325056-2325078 CCCAAATGAGGAGGGGAAAATGG + Intronic
1133478636 16:6147988-6148010 CCAAAGGGAGGGTCTGAGAATGG - Intronic
1133766583 16:8842522-8842544 GCAAAGAGAGGCTGGGACAAGGG + Intronic
1134829814 16:17313866-17313888 CTACAGGGAGAATGGGAATAAGG + Intronic
1135200728 16:20435897-20435919 AGAAAGGGAGGGTGGGAGAAGGG - Intronic
1135823848 16:25708837-25708859 AAAATGGAAGGATGGGAAAAGGG - Intronic
1136096312 16:27959577-27959599 CAAAAGGGAGGACGGGAGAAAGG + Intronic
1136536543 16:30902962-30902984 GCAAAGAGAGGCTGGGAAAGTGG - Exonic
1136555651 16:31006359-31006381 GCAGAGGGAGGATGAGAAAGGGG - Intronic
1136641152 16:31566418-31566440 CCACCTGGCGGATGGGAAAAAGG - Intergenic
1136948921 16:34691319-34691341 GCAAAGGAAGGAAGGAAAAAGGG + Intergenic
1137071849 16:35910527-35910549 CCCAAGTGAGGATGGGGAAGAGG + Intergenic
1137632555 16:49957146-49957168 CCAGTGGAAGGAAGGGAAAAAGG + Intergenic
1137796629 16:51225723-51225745 CCACAGGGACAATGGGAAACTGG - Intergenic
1137827548 16:51512201-51512223 GGAAGGGGAGGAGGGGAAAAAGG + Intergenic
1137915828 16:52428793-52428815 CCAATGAGATGATGGGATAAAGG + Intergenic
1138382129 16:56609868-56609890 CCACAGGGAGTTTGGGAAACCGG - Intergenic
1138549628 16:57740398-57740420 CCACAAGGAGGTTGGGAAACTGG - Intronic
1140844451 16:78873121-78873143 CCAGATGGAGGAAGAGAAAAAGG - Intronic
1141027210 16:80559900-80559922 CCAAGGGCAGGATGAGAGAATGG - Intergenic
1141067523 16:80926249-80926271 CCAAAAGGAGGAGGGGGAGAAGG + Intergenic
1141410500 16:83829697-83829719 CTACAGGGAGGCGGGGAAAAGGG + Intergenic
1141773029 16:86102350-86102372 AGAAAAGGAGGATGGAAAAAAGG - Intergenic
1141809951 16:86369130-86369152 CCAACTGGTGGTTGGGAAAAAGG - Intergenic
1142029765 16:87832698-87832720 ACAAAGGAGGGAAGGGAAAAAGG + Exonic
1142544380 17:689160-689182 CCCAAGAGAGGATGAGAGAAAGG + Intronic
1143417324 17:6759322-6759344 GTAAAGAGAGGATGTGAAAAAGG + Intronic
1143485506 17:7251657-7251679 GAAAAGGGAGGAAGGGAAAAGGG + Intronic
1143588239 17:7862885-7862907 CCAAAGTTAGGATGGGAAGGTGG + Intronic
1144364210 17:14526367-14526389 CCAAAGGCAGTTTGGGAAAGGGG - Intergenic
1145080558 17:19891324-19891346 ACAAGGGGAGGATGCGAAGAAGG + Intergenic
1145737719 17:27244718-27244740 CAAAAGGGAGGCTGAGAAAGGGG + Intergenic
1146565273 17:33907523-33907545 CCAAAGGGAGAATGAGTAATGGG - Intronic
1146645100 17:34571967-34571989 CCAGAGGGAGGAAGAGAAAGGGG + Intergenic
1147358783 17:39918336-39918358 CCAAAGGTAGGATGGGGAAGTGG - Intronic
1147606144 17:41774750-41774772 CCAAGGGGAGGAGGGGACCAAGG + Intronic
1148154505 17:45415131-45415153 CAAAAAGGAGGAAGGGAAAAAGG - Intronic
1148502620 17:48103258-48103280 TCACAGGGAGGATTGAAAAAAGG + Intergenic
1149220666 17:54412635-54412657 GCAAAGAGAGGCTGGGATAAGGG - Intergenic
1150386326 17:64764645-64764667 CGAAAAGGAGGAAGGGAAAAAGG - Intergenic
1150477509 17:65486233-65486255 ACAAAGGGGGGATGTGATAAGGG + Intergenic
1151409504 17:73912475-73912497 GGAAAGGGAGGAAGGGAAGAAGG - Intergenic
1152904929 17:82964992-82965014 CCACAGGGAGGACGGGGACATGG + Intronic
1152904940 17:82965033-82965055 CCACAGGGAGGACGGGGACATGG + Intronic
1153448215 18:5197099-5197121 GCAGACGGAGGATGGGAAGAAGG + Exonic
1153748223 18:8202258-8202280 CCAAGGGAGGGCTGGGAAAATGG - Intronic
1155500473 18:26482396-26482418 CCTAAGGAGGGATGGGAAAGAGG + Intronic
1155980514 18:32174873-32174895 CCCATGGGAGGAAGGGGAAAGGG + Intronic
1156697458 18:39784001-39784023 CCAAGGGGAGGAGGGTAGAAAGG + Intergenic
1156919647 18:42505166-42505188 CCTCAAGGTGGATGGGAAAAGGG + Intergenic
1156923943 18:42555351-42555373 ACAAGGGGAGGATGTGAAGAAGG + Intergenic
1157511176 18:48275995-48276017 ACAGAGGGAGGAGGGGAGAAAGG + Intronic
1157629029 18:49078721-49078743 GGAAAGGGAGGAAGGGAAGAAGG + Intronic
1158241590 18:55384694-55384716 CAAGATGGAGGATGGGAAAAAGG - Intronic
1158409310 18:57190791-57190813 CTACTGGGAGGATGGGAAAGTGG - Intergenic
1158473337 18:57758273-57758295 ACAAAGGGTGGGTGGGAACAAGG - Intronic
1158656078 18:59335560-59335582 AGAAGGGGAGGATGGGAAAGTGG + Intronic
1158811940 18:61047821-61047843 CCGCAGGGAGGATTGAAAAAAGG + Intergenic
1159062939 18:63535338-63535360 TCAAAGGTAGAATGGGAAAAAGG + Intergenic
1159284379 18:66329921-66329943 CCAAAGGAAGAAGGGAAAAAGGG - Intergenic
1160543738 18:79639295-79639317 CCAGAGGGAGGAGGGTAGAATGG - Intergenic
1160899206 19:1418717-1418739 CCGAAGGAAGGATGGGTAAGGGG + Exonic
1161201354 19:3016705-3016727 CGGAAGTGAGGATGGGAAGAAGG + Intronic
1162236567 19:9314346-9314368 TCACAGGGAGGATTGAAAAAAGG - Intergenic
1162334156 19:10049974-10049996 CCTAGGGCAGGATGGGCAAAGGG - Intergenic
1163040878 19:14601377-14601399 CCAGAAGGAGGATTGGAATATGG + Intronic
1163187914 19:15652723-15652745 CCTCAGGGAGGATGGGGGAAGGG - Intronic
1163209761 19:15831659-15831681 ACAAGGGGAGGATGCGAAAGAGG - Intergenic
1163216979 19:15886131-15886153 CCTCAGGGAGGATGGGGGAAGGG + Intronic
1163391454 19:17033358-17033380 CCACAGGGCTCATGGGAAAACGG - Intergenic
1163987077 19:20963310-20963332 CCAGATGGTGGATGGCAAAATGG + Intergenic
1165355032 19:35299378-35299400 CCAAGAGGAGGAAGGGTAAAGGG + Intronic
1165929127 19:39344671-39344693 CTGAAGGGATAATGGGAAAAGGG - Intronic
1166713802 19:44953752-44953774 GGCAAGGGAGGATAGGAAAAGGG + Intronic
1166911973 19:46165360-46165382 GCAAAGGGAGGATGTTACAAAGG + Intergenic
1166987061 19:46667198-46667220 CCAGAGGGGGGATGAGGAAAAGG - Intergenic
1167240253 19:48339143-48339165 CCAACTGGAGGCTGGGAAGAGGG + Intronic
1167633011 19:50637523-50637545 GAAAAGGAAGGATGGGCAAAGGG + Exonic
1167699064 19:51031772-51031794 TCAGAGGAAGGATGGGTAAAGGG - Intronic
1168411203 19:56141415-56141437 CCAGAGGTTGGATGGGAAGAGGG + Intronic
925357357 2:3251300-3251322 CTAAAGGGAGGGTGGGAAGAGGG + Intronic
925433099 2:3814130-3814152 CCAAAAGGAGGTGGGGAAAATGG - Intronic
925878470 2:8331534-8331556 CAAAAGGGAGAATTGGAAACAGG - Intergenic
926653482 2:15371768-15371790 GCAAAGGGGGGATGGAAAGAGGG + Intronic
927134332 2:20085592-20085614 GCAAAGAGAGGCTGGGATAAAGG - Intergenic
927448675 2:23187779-23187801 CCACAAGGAGGAAGGGAAAGGGG + Intergenic
928713392 2:34032653-34032675 CCTAAGGGAGGGTGGGCAGATGG + Intergenic
928753781 2:34500152-34500174 CCACAGAGAAGATGGGAAATTGG + Intergenic
929219153 2:39445473-39445495 CCAAAGAGAGACTGGGAAAGAGG + Intergenic
929230898 2:39558909-39558931 CCAGAGAGAGGTTGGGAGAATGG - Intergenic
929445776 2:41999987-42000009 CCAAAGAGGGGATGGGAGAAGGG + Intergenic
929488759 2:42378149-42378171 CCTAAGGGGGGCTGGGAAAATGG - Intronic
930053957 2:47237826-47237848 CCCAAAGGAGGATGGAAAAGTGG - Intergenic
930301486 2:49621325-49621347 CCAATGGGAGGTAGGGAGAATGG - Intergenic
932078502 2:68689451-68689473 CAAAAGGGAGGAGGGTATAATGG + Intronic
932159278 2:69446083-69446105 GCAAAGAGAGGCTGGGACAAGGG + Intergenic
932960777 2:76409743-76409765 TCGCAGGGAGGATTGGAAAAAGG - Intergenic
933138111 2:78761187-78761209 GCAAAGAGAGGATGGGATGAAGG - Intergenic
933236505 2:79870477-79870499 GGAAGGGGAGGAAGGGAAAAAGG + Intronic
934781100 2:96970257-96970279 ACTCAGAGAGGATGGGAAAATGG + Intronic
936090110 2:109496130-109496152 TCACAGGGAGGATGGAAAAAAGG - Intronic
936139720 2:109928982-109929004 CCAGAGGGAGAAAGGGGAAAGGG + Intergenic
936204976 2:110442504-110442526 CCAGAGGGAGAAAGGGGAAAGGG - Intronic
936249402 2:110855992-110856014 TCACAGGGAGGATTGAAAAAAGG - Intronic
936376905 2:111948603-111948625 AAAAAGGAAGGATGGGAAAATGG - Intronic
936466957 2:112762261-112762283 CCAAAGGAAGGAGGGAAGAAGGG - Intronic
936480864 2:112883784-112883806 CCAAATGCAGCATGGGCAAATGG + Intergenic
936483746 2:112908720-112908742 TCACAGGGAGGATTGAAAAAAGG - Intergenic
937594895 2:123660968-123660990 ACAAGGGGAGGATGTGAAGAAGG + Intergenic
937966313 2:127514333-127514355 CCAAACGGAGGATGCAAAAAGGG + Intronic
938294808 2:130171612-130171634 CCAGAGGGTGGAGGGGAGAAAGG - Intronic
938461823 2:131502232-131502254 CCAGAGGGTGGAGGGGAGAAAGG + Intergenic
939761449 2:146186759-146186781 AGAAAGGAAGGAAGGGAAAAGGG + Intergenic
939961496 2:148569562-148569584 ACAAAGGGAGGTGGGGAGAAAGG - Intergenic
940042102 2:149371487-149371509 CCAAAAAGAGGATGGGATGATGG + Intronic
940778232 2:157906362-157906384 ACAAATGGAGGATGGGAGAGAGG + Intronic
941048156 2:160699704-160699726 CCAAAATGAGAAAGGGAAAATGG + Intergenic
941473785 2:165923082-165923104 GAAGAGGGAGGATGGGAAGAGGG + Intronic
942519973 2:176793285-176793307 CCAGAGTGAGGCAGGGAAAAGGG - Intergenic
942639680 2:178048466-178048488 CCAAAGGGTGGACGGGTTAAGGG - Intronic
943328824 2:186534565-186534587 CCAAACCCAGGATGGTAAAATGG + Intergenic
943461094 2:188172063-188172085 ACAAAGGGAGGATGTGAAGGAGG + Intergenic
943657248 2:190522603-190522625 CAAAAGGGAGGAGGGCATAATGG - Intronic
943835498 2:192510325-192510347 ACAAAGGGAGGATGTGAAGGAGG - Intergenic
944376995 2:199057106-199057128 CCAAAGGAAATAAGGGAAAAGGG + Intergenic
944681298 2:202079354-202079376 CCAAAGTGAGGATGGAAAAAGGG + Intronic
944932326 2:204532426-204532448 CCAAATCTAGGATGGCAAAATGG + Intergenic
946167809 2:217876062-217876084 CAACAGAGAGGATGGGAACAGGG - Intronic
946227054 2:218269732-218269754 CCAAGGGGATGATGGGAAGGGGG + Intronic
946321141 2:218955221-218955243 CGAAAGGGAGGAGGCAAAAAGGG + Intergenic
946363602 2:219234922-219234944 CCAAGCGGAGGAGGAGAAAAAGG + Exonic
946557771 2:220878196-220878218 GAAAAGGGAGGATAGGAAAAGGG - Intergenic
947103556 2:226646550-226646572 CTGAAAGGAGGAAGGGAAAAGGG + Intergenic
947279306 2:228431392-228431414 ACAAAGGAAGGAAGAGAAAATGG + Intergenic
947351015 2:229245197-229245219 CCAAAGGGAACACAGGAAAAAGG - Intronic
947912749 2:233812047-233812069 ACAGAGGGAGGAGAGGAAAAAGG - Intronic
948274066 2:236694885-236694907 ACAAAGTCAGGATGAGAAAAGGG - Intergenic
948711749 2:239829446-239829468 CCAAAGGGAAGTGGAGAAAACGG + Intergenic
948846998 2:240687944-240687966 ACACAGGGAGCCTGGGAAAAGGG + Intergenic
948902557 2:240963831-240963853 CCGTAGGGAGGATGGGGCAAGGG + Intronic
949038921 2:241836007-241836029 TCACAGGGAGGATTGAAAAAAGG - Intergenic
1168994694 20:2124434-2124456 CCAAAGGGAGGATGGGAAAAGGG + Intronic
1169448067 20:5688764-5688786 CCGTGGGGAGGACGGGAAAAGGG - Intergenic
1169650699 20:7864066-7864088 CAAAAGGGAGGAGGGAAAAAGGG + Intergenic
1170074567 20:12405502-12405524 CCAAAGGGAGGAGTGTATAAGGG + Intergenic
1171494436 20:25545579-25545601 CTAAAGGGAGGAGGGCATAATGG - Intronic
1171963957 20:31515511-31515533 TCAAAGGCTGGGTGGGAAAAGGG - Intronic
1172160822 20:32866759-32866781 AGAAAGGGAGGAAGGGAAGAAGG - Intronic
1172823706 20:37761843-37761865 TCAAGAGCAGGATGGGAAAAGGG + Intronic
1172900925 20:38334400-38334422 TCAGAGGGAGGATGGGAGGATGG - Intronic
1172960105 20:38793041-38793063 CCAAAGGGGGAATGGATAAATGG - Intergenic
1173047991 20:39530998-39531020 TGAAAGGAAGGAAGGGAAAAAGG - Intergenic
1173146209 20:40526680-40526702 CCAAAGGGAGGAGATGGAAATGG + Intergenic
1173652215 20:44673639-44673661 GCAAAGAGAGGCTGGGACAAGGG - Intergenic
1173676318 20:44838828-44838850 CAAAAGGTAAGATGGGAAATGGG + Intergenic
1174175042 20:48639221-48639243 ACCAAGGGAGGATGGGAGACTGG + Intronic
1174276579 20:49408708-49408730 CACGAGGGAGGATGGGAGAATGG + Intronic
1174315497 20:49697386-49697408 TCAAATGAAGGATGGGACAATGG + Intronic
1174731912 20:52926159-52926181 CCAGAGGGAGGACGAGAAAGTGG + Intergenic
1174868100 20:54157455-54157477 CCAAATGGAAGATGCGCAAAAGG + Exonic
1174931869 20:54825011-54825033 CAAAAAGAAGGAAGGGAAAAAGG - Intergenic
1175190425 20:57208483-57208505 CTAATGGTAGGATTGGAAAATGG + Intronic
1175279696 20:57794823-57794845 ACAGAGGCAGGATGGGGAAAGGG - Intergenic
1175732472 20:61363200-61363222 CGGATGGGAGGATGAGAAAATGG - Intronic
1176654365 21:9576558-9576580 CCAAAGTCAAGTTGGGAAAAGGG - Intergenic
1176976147 21:15324803-15324825 CAAAAGGGAGGATGGGACAGTGG + Intergenic
1177134751 21:17297069-17297091 TCAAAGGGAGGATTGAAAAAAGG + Intergenic
1177446908 21:21209555-21209577 CATGAGGCAGGATGGGAAAAGGG + Intronic
1178022884 21:28430137-28430159 CCATAGGGAGAAAGTGAAAATGG + Intergenic
1178299793 21:31442710-31442732 CCAAAGAGAGGATGGGGCCAGGG + Intronic
1179414204 21:41185305-41185327 ACAAATGGAGGAAGGGAAAGGGG + Intronic
1180020537 21:45122671-45122693 TGAAAGGGTGGATGGGGAAAGGG - Intronic
1181098074 22:20519862-20519884 CCCCAGGGAGTATGGGAAGATGG - Intronic
1181114076 22:20620489-20620511 CCAGAGGGTGGAGGGGAGAAAGG - Intergenic
1181839970 22:25648469-25648491 GCAAAGTGTGGATGGGAATATGG + Intronic
1182079464 22:27518742-27518764 CCAGAGGCAGGAGGGAAAAAGGG - Intergenic
1182501715 22:30752953-30752975 CCAAAGGGAGGAGGGTACAGAGG + Intronic
1183276472 22:36901205-36901227 GCAAAGGTAGGAGGGGAACAGGG - Intergenic
1183523224 22:38308695-38308717 CCAGTGGGAGGAGGGGAAGAGGG + Intronic
1184149886 22:42631730-42631752 CCAAAGGGAGGATGCCAGACAGG + Intronic
1185418618 22:50722849-50722871 CCACAGAGAGGATGGGAGGAGGG - Intergenic
949486989 3:4549501-4549523 AGGAAGGGAGGAAGGGAAAAAGG - Intronic
950077020 3:10194534-10194556 CCAAAGGCAGGATGAGGCAAAGG - Intronic
950266307 3:11575705-11575727 CCATAGGGAGAATGGAAAGATGG - Intronic
951040756 3:17986726-17986748 CCAAAGGGAAGATGAAAAAAAGG + Intronic
951347361 3:21561671-21561693 CCAAAGAGAGGGTGGGAGATTGG + Intronic
952561660 3:34602261-34602283 CCACAAAGAGAATGGGAAAATGG + Intergenic
953177376 3:40564256-40564278 GCAAAGAGAGGCTGGGAAGAGGG - Intronic
953841073 3:46390629-46390651 ACAAGGGGAGGATGTGAAACAGG + Intergenic
955369003 3:58334399-58334421 CTAAAGGGAGTATGGCATAAGGG + Intronic
956737728 3:72251228-72251250 ACAAAGGAAGGATGGGAGATGGG + Intergenic
957142555 3:76380532-76380554 CCATAAGGAGGAGGCGAAAAAGG - Intronic
957164575 3:76655707-76655729 GGAAAGGGAGGAAGGGAGAAAGG + Intronic
957535128 3:81492667-81492689 AGAAAGGGAGAATGGGAGAAGGG - Intronic
957571548 3:81953105-81953127 CCAAAGGGCTGTTGAGAAAACGG - Intergenic
958466927 3:94470963-94470985 CCAAAGACAAGATGGGAGAACGG - Intergenic
958622434 3:96578439-96578461 CCAAAAGGAAAAGGGGAAAAAGG + Intergenic
960114952 3:113884915-113884937 GAAAAGGGAGGAAGGGAAAAGGG - Intronic
960139719 3:114140284-114140306 TCAGAGGTGGGATGGGAAAAAGG + Intronic
961345330 3:126260264-126260286 CTAGAGGGAGGATGGGGAAGAGG - Intergenic
961612645 3:128153048-128153070 TCACAGGGAGGATTGAAAAAAGG - Intronic
961852234 3:129832299-129832321 CCAGAGGGAGAAAGAGAAAAAGG + Intronic
962492050 3:135903880-135903902 AAAGAGGGAGGCTGGGAAAAAGG - Intergenic
962753330 3:138450583-138450605 CCCAAGAGAGAATGGGAGAATGG + Intronic
963026599 3:140925280-140925302 ACAAAGAGAGGATGTGAAAATGG - Intergenic
963481747 3:145884239-145884261 CCAAATGAAGGATGGATAAAAGG + Intergenic
963545511 3:146652906-146652928 CCACAGGGAAGCTGGGAATATGG - Intergenic
963814872 3:149818435-149818457 CCACTGGGAGGAAGGGGAAAAGG - Intronic
963831397 3:150013238-150013260 CCAAAGGCAGGATGAGAAATAGG + Intronic
963861662 3:150316719-150316741 CCAAAGGTAGGAAGGAAGAAAGG - Intergenic
963937764 3:151072382-151072404 CCAAAGGCAGGAAGGGAAGAGGG + Intergenic
964610604 3:158611296-158611318 CAGTAGGGAAGATGGGAAAATGG - Intergenic
965056400 3:163722216-163722238 CCAAAAGGAGGACATGAAAAGGG - Intergenic
965116684 3:164499477-164499499 CTCAAGGGAGAATGAGAAAAAGG - Intergenic
965854453 3:173071436-173071458 CCAAAGGAAAAATGGGCAAATGG + Intronic
967672429 3:192253419-192253441 AGAGAGGGAGGAAGGGAAAAGGG + Intronic
967712389 3:192724005-192724027 AGAAAGGGAGGAAGGGAAAAGGG + Intronic
968163298 3:196444586-196444608 ACAAAGGAAGGAAGGAAAAAAGG + Intergenic
969214374 4:5710727-5710749 CCACTAGGAGGATGGGTAAAGGG - Intergenic
969463408 4:7340786-7340808 CCAAGCGCAGGATGGGAATAGGG - Intronic
970152013 4:13099713-13099735 GCAAAGGGAGGGAGAGAAAATGG + Intergenic
970581450 4:17477600-17477622 AGAAAGGGAGGATGGGGAGAGGG - Intronic
970698967 4:18711918-18711940 ATCAAGAGAGGATGGGAAAAAGG - Intergenic
970793431 4:19887405-19887427 CCCAAGGGAGGATGGGGCAAAGG - Intergenic
972497251 4:39645488-39645510 CCAAGGGGAGGGTGGGAGGAGGG - Intergenic
972517675 4:39823486-39823508 TCAAAGGGAGGAAGAGACAAAGG + Exonic
973975892 4:56261961-56261983 CCACAGGGATTATGGGGAAATGG + Intronic
974064875 4:57068416-57068438 CCCAAGGGAGGCGGGGGAAACGG + Intronic
974781299 4:66556963-66556985 CCCAAGTGAGGATGGGGCAAAGG - Intergenic
974903946 4:68033893-68033915 GCAAAGAGAGGCTGGGACAAGGG - Intergenic
974949373 4:68569796-68569818 CCCAAGTGAGGATGGGACAGTGG - Intronic
974950868 4:68582044-68582066 CCCAAGTGAGGATGGGACAGGGG - Intronic
974958409 4:68671996-68672018 CCCAAGTGAGGATGGGACAGGGG - Intergenic
975074264 4:70185397-70185419 GCAAAGTCAGGATGGGAACATGG + Intergenic
975152232 4:71034378-71034400 ACAAAGGGAGGATGCGAAGGAGG - Intergenic
976631963 4:87247958-87247980 TCACAGGGAGGATTGAAAAAAGG + Intergenic
978040467 4:104054508-104054530 CCAAAGGTAGGAAAGGAAAAAGG - Intergenic
978354414 4:107856366-107856388 CAAAAAGGAGAATGGGCAAAAGG - Intronic
978487592 4:109273061-109273083 GGGAAGGGAGGATGGGAAAGGGG + Intronic
978592365 4:110339083-110339105 AGAAAGGGAGGAAGGGAAGAAGG - Intergenic
978956384 4:114617849-114617871 CCAAAGGAAGGATGAGAGTAAGG + Intronic
978964440 4:114724588-114724610 CAGAAGGGAGGAGGGCAAAAGGG - Intergenic
979318730 4:119299052-119299074 TTAATGGGAGGATGGCAAAAGGG - Intronic
979380111 4:119997202-119997224 GCAAAGAGAGGCTGGGACAAGGG - Intergenic
980291693 4:130853160-130853182 CCAAAGGAAGGATGGGAATTGGG + Intergenic
980420412 4:132552194-132552216 CCAAAGGAAACATGGGAAATAGG + Intergenic
980904111 4:138931144-138931166 GCAAAGAGAGGCTGGGATAAAGG - Intergenic
982196544 4:152921617-152921639 AAAAAGGAAGGAAGGGAAAAAGG - Intergenic
982293431 4:153802988-153803010 CCAAAGGAAGGAGGGGACAGAGG + Intergenic
982316569 4:154037788-154037810 GCAATGTGAGGAAGGGAAAAGGG + Intergenic
982318983 4:154059552-154059574 GCAAAGAGAGGATGGGACGAGGG - Intergenic
982415011 4:155120761-155120783 CCAAAAGGAGGAAGGTAATAAGG - Intergenic
982486183 4:155968386-155968408 TCACAGGGAGGATTGAAAAAAGG - Intergenic
982502130 4:156170586-156170608 CCAAAGAGAGGAGGGTAAAGGGG + Intergenic
984187791 4:176567404-176567426 CCAAAGGGAGTATGAGCTAATGG + Intergenic
985289051 4:188368383-188368405 GCAAATGGAAGATGGCAAAAGGG + Intergenic
985864566 5:2504318-2504340 ACAGAGGGTGGAAGGGAAAAAGG - Intergenic
986649956 5:9953493-9953515 CAAAAGGGAGGAGGGGATAATGG + Intergenic
988052434 5:26048327-26048349 GAAAAGGGAGGAAGGGAATAAGG + Intergenic
988587472 5:32520237-32520259 GAAAAGGGAGGATGGAAGAAGGG + Intergenic
989069652 5:37497244-37497266 AGGAAGGGAGGAAGGGAAAAGGG - Intronic
989133040 5:38126265-38126287 GGAAAGGGAAGAGGGGAAAAGGG + Intergenic
989157286 5:38356194-38356216 CCAAATGGAACATGGGAATATGG + Intronic
989193412 5:38692850-38692872 CCAAAACAAGGATGGGAAACAGG + Intergenic
991208793 5:64080849-64080871 CCAAAAGGAGGATGGATGAAGGG - Intergenic
991255912 5:64614713-64614735 CCAAGGAGGGGATGGGAATAGGG - Intergenic
992212039 5:74489982-74490004 CCATAGAGAGGAAGGGCAAATGG - Intergenic
993187508 5:84637955-84637977 GGGAAGGGAGGAAGGGAAAAAGG - Intergenic
994382191 5:99084709-99084731 TCCAAGGAAGGTTGGGAAAATGG - Intergenic
994612671 5:102064769-102064791 CCAAAGTGGAGATGGGATAATGG - Intergenic
994787178 5:104179992-104180014 CCAAAAGGAAGAAGGCAAAAGGG + Intergenic
994927720 5:106139879-106139901 CCAAAAGAAGGATGATAAAATGG + Intergenic
995112699 5:108445353-108445375 CAAAAGGCAGGAAGAGAAAATGG + Intergenic
995454047 5:112333305-112333327 AAAAAGGGGGGAAGGGAAAACGG + Intronic
995947693 5:117669654-117669676 CTGAAGGGAGAATGGGTAAAGGG - Intergenic
996725764 5:126672449-126672471 ACAAAGGGAGGATGTGAAGGAGG + Intergenic
996766729 5:127041694-127041716 CCAAAGGGAGAAGGAGGAAAGGG + Intergenic
996968492 5:129333793-129333815 CTAAATGGAAGATGGGAAGAAGG + Intergenic
997472341 5:134123970-134123992 CAAATGGAAGGATGGGAAAATGG - Intronic
997813760 5:136996769-136996791 TCACAGGGAGGATTGAAAAAAGG + Intronic
997964048 5:138344097-138344119 CCAAGAGAAGGAAGGGAAAATGG - Intronic
998260847 5:140630864-140630886 TCACAGGGAGCATGGGAGAAAGG - Intergenic
998270972 5:140706212-140706234 CATAGGGCAGGATGGGAAAAAGG - Exonic
998315331 5:141178076-141178098 CCAAAAGGAGAAAGGAAAAAAGG - Exonic
998319258 5:141214165-141214187 CCAAAAGGAGAAAGGAAAAAAGG - Exonic
998823389 5:146077045-146077067 CTAAAAGGATGATGGGAAATTGG - Intronic
998827914 5:146123615-146123637 CAAAAGGGAGGGGGGAAAAAAGG + Intronic
998955033 5:147430143-147430165 CAAAAGAGAGGGAGGGAAAAAGG + Intronic
1000073992 5:157767741-157767763 CCAAATGGAGGAAGGTACAAAGG + Intergenic
1001534011 5:172485951-172485973 GCAAAGGGAGGATAGGCAGAAGG + Intergenic
1001542645 5:172550326-172550348 CCAAAGGGAGGAGAGGCCAATGG - Intergenic
1001782800 5:174385075-174385097 CCAAAGGGAAAAGGGGAAAGTGG - Intergenic
1001932274 5:175681681-175681703 GCAAAGGGAGGAAGGGAGGAAGG + Intronic
1002827981 6:791016-791038 TCACAGGGAGGATTGAAAAAAGG - Intergenic
1003256223 6:4477259-4477281 CCAAAGGGAGGATTTTTAAATGG + Intergenic
1003361533 6:5431073-5431095 TCAAAGGAAGGATGTGTAAAAGG - Exonic
1003455285 6:6276231-6276253 CCAAAGAGAGGATTGGAAGCAGG + Intronic
1003665923 6:8111340-8111362 CCAAATGCAGGAAGGGAGAAAGG - Intergenic
1004347195 6:14859426-14859448 CATAAGAGAGGATGGAAAAAAGG - Intergenic
1004545742 6:16596776-16596798 CCAAAGGCAAGATGGGTAGAAGG + Intronic
1004751314 6:18565531-18565553 AGAAAGGGAGGAAGAGAAAAAGG - Intergenic
1004751463 6:18566140-18566162 AGAAAGGGAGGAAGGGAAGAAGG - Intergenic
1005251023 6:23946292-23946314 CCAAGGGTAGAATGGGTAAAAGG - Intergenic
1005808991 6:29502143-29502165 CCAAAGGGAGGAGGGGGAAATGG + Intergenic
1005995404 6:30927964-30927986 CCAGAGGGAGGAGGGAAAGAAGG + Intergenic
1006193535 6:32223558-32223580 CCATAGGGAAGAGGGGAAGAGGG - Intronic
1007300812 6:40866640-40866662 GCAAAGAGAGGCTGGGACAAGGG + Intergenic
1007713427 6:43839010-43839032 CAAAAGGGAGGGTGGGAGGAGGG + Intergenic
1007720003 6:43879217-43879239 CCCAGGGGAGGATGGGGCAAGGG + Intergenic
1007950603 6:45868790-45868812 TTAAAGGAAGGATGGGAAAATGG + Intergenic
1008043422 6:46827372-46827394 AGAAAGGGAAGATGGAAAAATGG - Intronic
1008124011 6:47648651-47648673 CTGAATGGAGGAGGGGAAAAGGG - Intergenic
1008136480 6:47783381-47783403 AGAAAGGGAGGAAGGGAAGAAGG - Intronic
1008395064 6:50996557-50996579 CCAAAGGAAGGGTGGAAACATGG - Intergenic
1009624282 6:66118461-66118483 CCAAAGGGTGGAAAGGAAAGCGG + Intergenic
1009645524 6:66396083-66396105 CCAAATGGTGGATGTGAAAAGGG + Intergenic
1010766859 6:79784947-79784969 CCAAAGGAAGGGGGGGAAATAGG + Intergenic
1010850090 6:80764259-80764281 CTCAAGGAAGAATGGGAAAAGGG + Intergenic
1011340407 6:86307336-86307358 CCAAAGGGTGGCTGGCAAGATGG - Intergenic
1011491719 6:87899986-87900008 CCAACCGGTGGATGGGAAAGAGG + Intergenic
1011885618 6:92091099-92091121 TCCAATGGAGGATGGCAAAAGGG + Intergenic
1011997731 6:93614397-93614419 CAGAATGGAGGATGGGAAATAGG - Intergenic
1012686286 6:102254294-102254316 CAAAAGGGAGTTAGGGAAAAGGG - Intergenic
1013678997 6:112501884-112501906 CCCAAGGGAGGAAGGGAGCACGG - Intergenic
1013885673 6:114963109-114963131 CCAAAAGGAGGAAGGGAGAGAGG - Intergenic
1014288473 6:119530599-119530621 CCAAAGGAAGGAAGGAAAAGAGG - Intergenic
1014535193 6:122606192-122606214 ACATAGGGAAGATGTGAAAATGG + Intronic
1015026024 6:128533360-128533382 CTAAAGGGAGAATGGGATATGGG + Intergenic
1015410973 6:132893582-132893604 ACAAAGGCAGGATAGCAAAATGG + Intergenic
1016648359 6:146435305-146435327 CCAAACGGATGATGGGATGATGG + Exonic
1016694162 6:146973566-146973588 CAAAGGGGAGCAGGGGAAAATGG - Intergenic
1017010163 6:150058002-150058024 TCAGAGAGAGGATGGGAAAAAGG + Intergenic
1017529414 6:155273886-155273908 CCCAAGGAAGGAAGAGAAAAAGG + Intronic
1017533114 6:155316817-155316839 CCAAAGGCAGAAGGGCAAAAAGG + Intergenic
1017951763 6:159141233-159141255 ACAAAGGCAGGATGGGAAGGAGG - Intergenic
1018135882 6:160778160-160778182 GCAAAGGGAGGCTGGGATGAGGG - Intergenic
1018391416 6:163344564-163344586 CCAAAGCCAGGTTGGGAAATAGG + Intergenic
1018623384 6:165752784-165752806 CCTAAGGGAGGCTGCGAAGAAGG + Intronic
1019042773 6:169120226-169120248 CCAAAGGCCTGATGGGAGAATGG + Intergenic
1019210138 6:170398056-170398078 CAGATGGGAGGATGGGAAAGAGG + Intronic
1019831507 7:3335535-3335557 CCAAATGGAAGATGGGGACAGGG + Intronic
1020359292 7:7310158-7310180 CTAAAGAGAGAAAGGGAAAATGG - Intergenic
1020735460 7:11943764-11943786 GGAAAGGGAGGAAGGGAATAAGG - Intergenic
1020756879 7:12213937-12213959 CCAAAGAGAGGAAGGTACAACGG - Intronic
1020807603 7:12809566-12809588 CCAAAGGGAAGAGGGGAACAGGG - Intergenic
1021592632 7:22280409-22280431 CCAACCTGAGCATGGGAAAAGGG - Intronic
1022109249 7:27218221-27218243 ACAAAGGGAGGATGGGAGGGAGG - Intergenic
1022161740 7:27717758-27717780 AGAAAGGGAGAAAGGGAAAAAGG - Intergenic
1022272860 7:28827084-28827106 CCAGAGGGAGGCTTTGAAAATGG + Intergenic
1022866229 7:34423975-34423997 AAAAAGGGAGGATCGGAAAATGG - Intergenic
1024504911 7:50154222-50154244 CCACAGGGGGAAGGGGAAAATGG - Intronic
1025005894 7:55354491-55354513 CCAAAGGGAGGAAGGTAATCAGG - Intergenic
1025712353 7:63925245-63925267 CCAAAGGGAGTATTTAAAAAGGG + Intergenic
1026592458 7:71708706-71708728 CCAAAAGGAGGGAGGGAGAAAGG - Intronic
1027296328 7:76775730-76775752 TGAAAGGGAGGATGGAATAAGGG + Intergenic
1027869849 7:83693487-83693509 CCAAAGGAAGGAGGGTATAATGG + Intergenic
1028651515 7:93155349-93155371 CCACAGTGAGGAAGGAAAAAAGG + Intergenic
1028690274 7:93642707-93642729 ACAAAGGGAGGATGTGAAGGAGG - Intronic
1028697856 7:93737391-93737413 CCAAAGGGAGGTTGGGTATTAGG + Intronic
1028904920 7:96142275-96142297 CCAACAGGAGGAAGGGAAAGAGG - Intronic
1028965001 7:96792230-96792252 GCAAAGGGAGGAAGTGAGAAAGG + Intergenic
1029290886 7:99501377-99501399 TCGCAGGGAGGATGGAAAAAAGG + Intronic
1030201149 7:106906179-106906201 AAAAAGGGAGGCAGGGAAAAAGG - Exonic
1030407823 7:109137012-109137034 CCAAAGCAAAGATGGGCAAATGG - Intergenic
1030411365 7:109184286-109184308 ATAATGGGAGGCTGGGAAAAGGG + Intergenic
1030662167 7:112231596-112231618 AAAAAGGGAGGATGGGGAGATGG - Intronic
1030720409 7:112864232-112864254 CCTATTGGAGGGTGGGAAAATGG + Intronic
1031906178 7:127462302-127462324 CCAAAGCGAAAATGGGCAAATGG + Intergenic
1031995369 7:128226907-128226929 GCAATGGGTGGATGGGAAGATGG - Intergenic
1032746307 7:134790118-134790140 AGAGAGGGAGGAAGGGAAAAGGG + Intronic
1032749590 7:134825189-134825211 GGAAAAGGAGCATGGGAAAAGGG + Intronic
1033492723 7:141860109-141860131 CCAAAGGCAGGAGGAAAAAAGGG + Intergenic
1033930448 7:146513381-146513403 CCAAACGGAAGATGGTAAGAAGG - Intronic
1034051723 7:147990889-147990911 CTCCAGGGAGGAGGGGAAAAGGG - Intronic
1034334233 7:150310200-150310222 ACAAAGGGAGGATGTGAAAGAGG - Intronic
1034397772 7:150840183-150840205 CCAGAGGGAGGAAGGGGACATGG + Intronic
1034580328 7:152035840-152035862 CCCAAGTGAGGATGGGGAAGGGG + Intronic
1035521141 8:275718-275740 TCATGGGGAGGCTGGGAAAATGG + Intergenic
1035541908 8:446579-446601 CTAAAGTGAGGCAGGGAAAAGGG + Intronic
1035892632 8:3362270-3362292 TGGAAGGGAGGATGGGAAAATGG - Intronic
1036165969 8:6434007-6434029 CCATAGGGAGGCTGGAAAACGGG - Intronic
1036339822 8:7905860-7905882 GCAAAGAGAGGCTGGGACAAGGG + Intergenic
1036382335 8:8244775-8244797 CCCAAGTGAGGATGGGGCAAAGG - Intergenic
1036607021 8:10316599-10316621 CAAAAGGGAGGAAGGGAGAGAGG - Intronic
1036655992 8:10677871-10677893 ACAAGGGCAGGATGGGGAAATGG - Intronic
1037166087 8:15830753-15830775 CCAAAGGGAGGAAGGTGGAAGGG + Intergenic
1037410375 8:18589493-18589515 CCAAAAGGAAGATGACAAAAGGG + Intronic
1038720627 8:30032378-30032400 CCTAATGGAGAATGGGAGAAGGG - Intergenic
1039110853 8:34039466-34039488 CCAAAAGCAGGAGGAGAAAAAGG + Intergenic
1039151548 8:34512243-34512265 CAAAAGGAAGGATGGAAAGAAGG - Intergenic
1039467482 8:37795107-37795129 GCAAATGGAGGAAGGGAGAAGGG - Intronic
1039677674 8:39687612-39687634 GAAATGGGAGGATGGGGAAAGGG - Intronic
1040797199 8:51299287-51299309 TCACAGGGAGGATTGAAAAAAGG - Intergenic
1041019991 8:53629076-53629098 CCAAAGGAAAGATGGGCAAAAGG - Intergenic
1041316116 8:56564410-56564432 CCAAAGGGAGGGAGGAAAGAAGG - Intergenic
1042643496 8:70960365-70960387 CAAAATGGATGATGGAAAAATGG - Intergenic
1042919246 8:73906233-73906255 TCATGGGGAGGATTGGAAAAAGG + Intergenic
1042928282 8:73989102-73989124 TCCAAGGGAGGAGGGGGAAATGG - Intergenic
1043478020 8:80623940-80623962 AGAAAGGGAGGAAGGAAAAAAGG + Intergenic
1043752323 8:83953226-83953248 CCAAAGGGAGTTGGGGAACAAGG + Intergenic
1043754114 8:83980645-83980667 AGAAAGAGAGGAGGGGAAAAAGG + Intergenic
1044212239 8:89563285-89563307 AGAAAGGGAAGATGGGAAAAGGG - Intergenic
1044291193 8:90472462-90472484 AGAAAGGAAGGATGGGAGAAAGG - Intergenic
1044396575 8:91720415-91720437 CCAAAGGGAGGAGGGTAGAATGG + Intergenic
1044417262 8:91951239-91951261 GCAAAGAGAGGCTGGGACAAGGG - Intergenic
1044890606 8:96831472-96831494 GGAATGGGAGGATGGGAAGAAGG + Intronic
1045012434 8:97969830-97969852 GCAAAGGGGGCATGGGTAAAGGG + Intronic
1045125905 8:99088480-99088502 ACAATGGGAGAAGGGGAAAAAGG + Intronic
1045224348 8:100229937-100229959 AAAAAGGGATGATGTGAAAATGG - Intronic
1045317130 8:101052856-101052878 GCAGAGGGAGGATGGCAGAAGGG - Intergenic
1045826970 8:106409269-106409291 CCAAAGGGAGGATGGAGAGGAGG + Intronic
1048716929 8:137281548-137281570 CCTAAGTGAGGATGGGACAAAGG - Intergenic
1048717851 8:137287660-137287682 CCTAAGTGAGGATGGGACAAAGG - Intergenic
1049118180 8:140708465-140708487 CCGAAGGTAGGGTGTGAAAAAGG - Intronic
1050091108 9:2016829-2016851 CAAACGGGAGGAAGGGAAGACGG - Intronic
1050868220 9:10531384-10531406 ACATAGGGATGATGGGGAAATGG + Intronic
1051187491 9:14475477-14475499 CCAAAGAAAGCATGAGAAAATGG + Intergenic
1051261109 9:15265640-15265662 AAAAAGGGAGGAGGGGAAAAAGG + Intronic
1052012324 9:23425037-23425059 CAAATGGGAGGTTGGAAAAATGG - Intergenic
1052451251 9:28634392-28634414 GTAAAGGAAGGATGGGGAAAAGG - Intronic
1052660270 9:31419972-31419994 CCTAAAGGAGTATGTGAAAAAGG + Intergenic
1053477645 9:38393606-38393628 CCAAAAGGAGGTAGGGGAAAGGG - Intronic
1053590439 9:39509043-39509065 TCACAGGGAGGATTGAAAAAAGG + Intergenic
1053624935 9:39859808-39859830 TCACAGGGAGGATTGAAAAAAGG - Intergenic
1053848298 9:42264441-42264463 TCACAGGGAGGATTGAAAAAAGG + Intergenic
1053879935 9:42583420-42583442 TCACAGGGAGGATTGAAAAAAGG + Intergenic
1054218962 9:62390890-62390912 TCACAGGGAGGATTGAAAAAAGG + Intergenic
1054231755 9:62518279-62518301 TCACAGGGAGGATTGAAAAAAGG - Intergenic
1054575862 9:66856246-66856268 TCACAGGGAGGATTGAAAAAAGG - Intergenic
1054835052 9:69668356-69668378 GGAAAGTGAGGAAGGGAAAAGGG - Intronic
1056292530 9:85158089-85158111 CCACAGGGAGGGAGGGAAAGAGG - Intergenic
1056448204 9:86687095-86687117 CCAAATTGTGGATGAGAAAAAGG + Intergenic
1056500506 9:87203972-87203994 ACCAAAGGAGGATGGGAACAGGG + Intergenic
1056971500 9:91208632-91208654 CCAACTAGATGATGGGAAAATGG + Intergenic
1057310460 9:93939860-93939882 TAAAAGGGAGGATTGAAAAAGGG + Intergenic
1057316890 9:93975304-93975326 CTGAAGGGAGGATGGGATAGAGG + Intergenic
1057509377 9:95664965-95664987 TCACAGGGAGGATTGAAAAAAGG + Intergenic
1057526196 9:95804181-95804203 TCACAGGGAGGATTGAAAAAAGG + Intergenic
1057914954 9:99048226-99048248 CCAGAGGGAGTAGGGGAGAAAGG + Intronic
1058603854 9:106699940-106699962 CTGAAGGGAGCATGGGAAGAGGG - Intergenic
1058612560 9:106791477-106791499 GCAAAGAGAGGCTGGGACAAGGG - Intergenic
1058749221 9:108022789-108022811 CAAAAGGGAGTCTTGGAAAAGGG - Intergenic
1058856704 9:109069446-109069468 TTAAAAGGAGAATGGGAAAAAGG - Intronic
1059125937 9:111685019-111685041 CCACAGGGCCTATGGGAAAATGG + Intergenic
1059589042 9:115637667-115637689 AAAAAGGGAGGGAGGGAAAAAGG + Intergenic
1059612108 9:115909718-115909740 ACAAAGGTAGGATAGAAAAATGG + Intergenic
1060769414 9:126320648-126320670 TGCAAGGGAGGATGGGAAATTGG - Intergenic
1061260027 9:129475110-129475132 CCAAAGGGGAGGTGGCAAAATGG - Intergenic
1062374648 9:136256471-136256493 CCAATGGGAGGAGGGGAATCTGG - Intergenic
1185754596 X:2643255-2643277 TCAAAGGGAGGATGGGGCACCGG + Intergenic
1185991225 X:4894861-4894883 GCAAAGGGAGGCTGGGATGAAGG - Intergenic
1186315375 X:8364197-8364219 CCAAAGGGAGGGTAGGAAAAGGG + Intergenic
1186460564 X:9745407-9745429 TCAAGGGGAGAATGGGAATAAGG - Intronic
1186934765 X:14436325-14436347 GGGAAGGGAGGATGGGAAGATGG - Intergenic
1187150686 X:16679037-16679059 ACAAAGAGAGGAGGGGAGAAGGG + Intronic
1187528924 X:20079196-20079218 CCAAGGGCAGCATGGGAAATAGG + Intronic
1187897289 X:23994193-23994215 CCAAAGGGAGAATGGTCAAATGG + Intronic
1189424621 X:40886978-40887000 CTAGAGGGAGGAGGGGAGAAGGG - Intergenic
1189744210 X:44153586-44153608 CCAAAGGAAGGTTAGGAAACAGG + Intronic
1189931812 X:46019957-46019979 CCAAAGGGAGTAAGGGACTAAGG - Intergenic
1190118272 X:47639640-47639662 ACAAAGGGAGGCTTGGAAAGGGG - Intronic
1191846116 X:65549512-65549534 CCAAAGGGAGGAGGGTGAACAGG + Intergenic
1192161746 X:68793494-68793516 CCAAAGGAAGAATGGGTTAATGG + Intergenic
1192656188 X:72997584-72997606 CCAAAGCTAAGATGGAAAAAAGG + Intergenic
1192665932 X:73085417-73085439 CCAAAGCTAAGATGGAAAAAAGG - Intergenic
1192779584 X:74280600-74280622 TAAAAGGGAGAATGGGAAAAAGG + Intergenic
1192830855 X:74749619-74749641 TGAAAGGGAGGTTGGGAAAGGGG - Intronic
1194367272 X:93026208-93026230 GCAAAGAGAGGCTGGGACAAGGG - Intergenic
1194845595 X:98803815-98803837 ATAAAGGTAGGATGAGAAAAAGG - Intergenic
1195681451 X:107549969-107549991 CCAGAGGAAGGGTGTGAAAAAGG - Intronic
1195878969 X:109572962-109572984 CCAAAGGGAGGAAGGGAAGTAGG - Intergenic
1196262281 X:113597362-113597384 ACTAAGGGAGGATTGGTAAAAGG - Intergenic
1196867130 X:120080389-120080411 CCAAAGGGGGGAATGGAAATAGG - Intergenic
1196875969 X:120155893-120155915 CCAAAGGGGGGAATGGAAATAGG + Intergenic
1197297853 X:124740914-124740936 CCAGAGAGAGGAAGGGAGAAGGG + Intronic
1198599230 X:138266750-138266772 GCAAAGAGAGGCTGGGACAAGGG + Intergenic
1198977850 X:142357398-142357420 CTAAAAGGAGGATGGGGAAAGGG - Intergenic
1199680941 X:150224193-150224215 CCAAGGAGAGGAGGGGAAACAGG - Intergenic
1200222687 X:154399237-154399259 CCAAACGAGGGACGGGAAAAGGG - Intronic
1200307355 X:155041269-155041291 ACAAAGGGGGAAGGGGAAAATGG - Intronic
1200675482 Y:6142467-6142489 GCAAAGAGAGGCTGGGACAAGGG - Intergenic
1200819320 Y:7566075-7566097 CCAAAAGCAGGAAGGGAAAGAGG + Intergenic
1201452910 Y:14135898-14135920 CCAAAGGGAGGAGAGGAACAAGG + Intergenic