ID: 1168995557

View in Genome Browser
Species Human (GRCh38)
Location 20:2130223-2130245
Sequence TAAGTGGCGCCCGTTTATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 18
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 17}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168995551_1168995557 9 Left 1168995551 20:2130191-2130213 CCGTACTCTCTCTCCTGCGTGGG 0: 1
1: 0
2: 0
3: 17
4: 166
Right 1168995557 20:2130223-2130245 TAAGTGGCGCCCGTTTATCTGGG 0: 1
1: 0
2: 0
3: 0
4: 17
1168995554_1168995557 -4 Left 1168995554 20:2130204-2130226 CCTGCGTGGGTGTTTGTGGTAAG 0: 1
1: 0
2: 1
3: 6
4: 96
Right 1168995557 20:2130223-2130245 TAAGTGGCGCCCGTTTATCTGGG 0: 1
1: 0
2: 0
3: 0
4: 17

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168995557 Original CRISPR TAAGTGGCGCCCGTTTATCT GGG Intronic
902181643 1:14693718-14693740 TCAGAGGCACCCGTTTTTCTTGG + Intronic
911047524 1:93640606-93640628 TCAGTGGCTTCTGTTTATCTGGG - Intronic
1103929167 12:124440142-124440164 TCAGTGGCACCCGCTTTTCTGGG + Intronic
1144611042 17:16715910-16715932 CAAGTGGCGCACGTTGATATTGG + Intronic
1149815902 17:59723600-59723622 TAAGTGGAGCCTGTATATGTCGG + Intronic
1168995557 20:2130223-2130245 TAAGTGGCGCCCGTTTATCTGGG + Intronic
1176064015 20:63184889-63184911 CAAGGGGCTCCTGTTTATCTGGG + Intergenic
968096557 3:195935282-195935304 TAAGGAGCTCCCGTATATCTTGG + Intergenic
982086571 4:151842014-151842036 TAAGTGGTGCCCTTTTTCCTGGG + Intergenic
995116082 5:108481326-108481348 TAAGTGGAACCTGTTTATGTTGG - Intergenic
996543109 5:124650065-124650087 TAACTGGCGCTAGTTTATATTGG - Intronic
1000717974 5:164670119-164670141 TGAGTTGCGCCAGTTTGTCTGGG + Intergenic
1001588841 5:172851788-172851810 TAAGTGGAGCCCTTTTACCCAGG - Intronic
1002370750 5:178752151-178752173 TAACTGGCTTCTGTTTATCTGGG + Intergenic
1005256674 6:24010902-24010924 CAAGTGGAGACTGTTTATCTGGG - Intergenic
1016058346 6:139602517-139602539 GAAGAGGGGCCCTTTTATCTAGG - Intergenic
1018820036 6:167367272-167367294 TAAGTAACACCCATTTATCTTGG + Intronic
1191624961 X:63260920-63260942 TAAGGGGGGCCCTTTTATATGGG - Intergenic