ID: 1168995913

View in Genome Browser
Species Human (GRCh38)
Location 20:2133154-2133176
Sequence GTCCATGTGGACCTCTCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 1, 2: 2, 3: 21, 4: 195}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168995906_1168995913 19 Left 1168995906 20:2133112-2133134 CCCCTTGGCTTAGTGGGCTTTAA 0: 1
1: 0
2: 0
3: 10
4: 106
Right 1168995913 20:2133154-2133176 GTCCATGTGGACCTCTCTGTGGG 0: 1
1: 1
2: 2
3: 21
4: 195
1168995908_1168995913 17 Left 1168995908 20:2133114-2133136 CCTTGGCTTAGTGGGCTTTAACT 0: 1
1: 0
2: 0
3: 7
4: 117
Right 1168995913 20:2133154-2133176 GTCCATGTGGACCTCTCTGTGGG 0: 1
1: 1
2: 2
3: 21
4: 195
1168995903_1168995913 29 Left 1168995903 20:2133102-2133124 CCAGTGAGTTCCCCTTGGCTTAG 0: 1
1: 0
2: 4
3: 7
4: 121
Right 1168995913 20:2133154-2133176 GTCCATGTGGACCTCTCTGTGGG 0: 1
1: 1
2: 2
3: 21
4: 195
1168995907_1168995913 18 Left 1168995907 20:2133113-2133135 CCCTTGGCTTAGTGGGCTTTAAC 0: 1
1: 0
2: 0
3: 3
4: 86
Right 1168995913 20:2133154-2133176 GTCCATGTGGACCTCTCTGTGGG 0: 1
1: 1
2: 2
3: 21
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168995913 Original CRISPR GTCCATGTGGACCTCTCTGT GGG Intronic
903515050 1:23904720-23904742 GTCCATGAAGTGCTCTCTGTAGG + Intronic
904282214 1:29428557-29428579 GTCCATGTGGTCCTCACTCAGGG - Intergenic
908019158 1:59881959-59881981 CTTCATTTGGTCCTCTCTGTTGG - Intergenic
909527541 1:76643654-76643676 TGCTATGTGGGCCTCTCTGTTGG + Intergenic
910673021 1:89792257-89792279 GGCCATGTGGGCCTCTTTATAGG - Intronic
912315554 1:108664677-108664699 CTCCATGTGGGCCTCTCCGTGGG - Intergenic
913366833 1:118048166-118048188 ATCCTTGTGGACCTATTTGTAGG + Intronic
915104754 1:153526878-153526900 GTCCATGTGGAACTGTCTTACGG + Intergenic
915224667 1:154403814-154403836 GTGCATCTGGATCTTTCTGTAGG - Intergenic
915251092 1:154589204-154589226 GTCCATTTGAACCTGTCTGATGG - Intronic
915961076 1:160267270-160267292 CGCCATATGGACCCCTCTGTAGG + Intergenic
917303771 1:173606245-173606267 CTCCCTGTGGATCTCTCTATAGG + Intergenic
917484618 1:175444395-175444417 GTTCATGTGCACCTCTTTCTTGG - Intronic
918051032 1:180972476-180972498 GTTCATGTGTACCTGTCTGGTGG + Intergenic
919851517 1:201676189-201676211 TTCCAGGAGGACCTCTCTGCAGG - Intronic
922493111 1:226034545-226034567 GGCCATGTGGACCTCTTGATAGG - Intergenic
922887245 1:229029422-229029444 GTCCATGTGGACCCCTCAGCTGG + Intergenic
923210869 1:231803189-231803211 CTCTATGTGGGCCTCTCTATAGG + Intronic
1066002414 10:31116783-31116805 GTCCATGTGGAAGTTTCTGTGGG - Intergenic
1066404869 10:35108820-35108842 GTCCCTGTGGACCTCTCCATGGG + Intergenic
1067767220 10:49095860-49095882 CTCCATCTGTACCTCTCTTTGGG + Intronic
1067790263 10:49282561-49282583 GGCCATGTTCACCTTTCTGTGGG + Intergenic
1067978058 10:51048586-51048608 CTTCATGTGGATCTTTCTGTGGG + Intronic
1068625834 10:59245466-59245488 GACCCTGTGGATCTTTCTGTGGG + Exonic
1070010671 10:72470911-72470933 ATTCATGTGGAACTATCTGTAGG - Intronic
1072171107 10:92862650-92862672 GTCCATATGGACTGCTATGTGGG + Intronic
1073956932 10:108883231-108883253 ATACTTGGGGACCTCTCTGTGGG + Intergenic
1075482931 10:122797926-122797948 GTCCATGTGGGCACCTCTGTTGG - Intergenic
1076346220 10:129780522-129780544 TTTAATGTAGACCTCTCTGTGGG - Intergenic
1077208126 11:1353782-1353804 GGCCATGGTGACCTCTCTGGGGG - Intergenic
1077283276 11:1754908-1754930 GTCCAGGTGGACCTGCCAGTAGG + Exonic
1078406564 11:11075054-11075076 GTCCAGGGGGATGTCTCTGTGGG + Intergenic
1078581289 11:12541517-12541539 TTCCATCTGGACATCTCTGAAGG + Intergenic
1079161758 11:18001465-18001487 TGCCATGTGGACCTTTCTATTGG - Intronic
1081083217 11:38768730-38768752 GTCCATGGGGGCCACTCTGCTGG - Intergenic
1081453373 11:43195311-43195333 GGTCATGTGGACCTGTGTGTGGG - Intergenic
1082397827 11:52187817-52187839 GGACATTTGGACCTCTCTGAGGG + Intergenic
1084027271 11:66459083-66459105 CTTCATGTGGACCTCTCTGGAGG - Intronic
1084394638 11:68901124-68901146 CGCCATGTGGACCTCTAGGTAGG - Intronic
1086397488 11:86431780-86431802 GTCCAGGTGACCCGCTCTGTGGG - Intergenic
1088281170 11:108136292-108136314 GTACATGTGCAGGTCTCTGTTGG + Intronic
1089291815 11:117441818-117441840 CTTCATGTGGACCCCTCTGCCGG - Intronic
1089742166 11:120592030-120592052 ATGCAGGTGGACCTCTCTTTAGG + Intronic
1091401975 12:186646-186668 TTCCACGTGGGCCTCTCTATTGG + Intergenic
1092057491 12:5520153-5520175 GATCATGGGGACCTCTCTGTGGG + Intronic
1093007775 12:14068981-14069003 ACCCATGTGGGCCTCTCTGTAGG - Intergenic
1093467694 12:19466994-19467016 GTTCATGTGGACTTCTTTGGAGG + Intronic
1094029189 12:25991647-25991669 CACCATGTGGACCTCTCCATAGG + Intronic
1094091452 12:26654765-26654787 TGCCATGTGGGCCTTTCTGTAGG - Intronic
1094523309 12:31215584-31215606 GTCCATGAGGGCTGCTCTGTTGG - Intergenic
1096590198 12:52653163-52653185 GTCCATGTGGCCAACTATGTGGG + Intergenic
1099283241 12:80679933-80679955 ATCCATTTGGAAGTCTCTGTTGG - Exonic
1099840662 12:87961319-87961341 GAACATGTTGGCCTCTCTGTTGG + Intergenic
1100450443 12:94700858-94700880 TTCCATGTGGGCCTCTCTATGGG + Intergenic
1100615265 12:96226515-96226537 GGACATGTGGACATCTGTGTGGG - Intronic
1101311136 12:103580376-103580398 GCCCATCTGGCCCTCTCTGCAGG + Intergenic
1101750408 12:107578826-107578848 GGACCTGTGGACCTATCTGTGGG - Intronic
1102530208 12:113540752-113540774 TTCCATGTGGACCTCCCCATAGG + Intergenic
1103184015 12:118940547-118940569 TGCCATGTGGACCTCTCCATAGG + Intergenic
1104357532 12:128101086-128101108 CCCCATGTTGGCCTCTCTGTAGG + Intergenic
1104658050 12:130588594-130588616 GACAATGAGGACCTCTCTGGTGG - Intronic
1104908397 12:132227859-132227881 GTCCATTTGCACATCCCTGTGGG - Intronic
1107415430 13:40195582-40195604 TACCATGTAGACCTCTCTGAGGG - Intergenic
1107950189 13:45454431-45454453 GTCTATGCAGCCCTCTCTGTGGG + Intergenic
1108596353 13:51953257-51953279 GGCCATGTGGAGACCTCTGTGGG - Intronic
1108859557 13:54838520-54838542 GTGCATGTGGATATTTCTGTAGG + Intergenic
1112428647 13:99329643-99329665 GGCCATGTGGACCTCTCCACAGG - Intronic
1113041272 13:106106181-106106203 GTCCATGTGGGCCCCTCGCTTGG - Intergenic
1113683730 13:112263114-112263136 TGCCATGTTGACCTCTCCGTGGG + Intergenic
1115696382 14:35903671-35903693 CTCCATGTGGACCTTTCCATAGG - Intronic
1116461493 14:45180388-45180410 TGCCATGTGGACCTCTTCGTAGG + Intronic
1117608685 14:57460262-57460284 GTTCATGTGGATATATCTGTAGG + Intergenic
1118492975 14:66279771-66279793 CTCCATGTGGGCCTCACTATGGG - Intergenic
1120330176 14:83082461-83082483 TGCCATGTGGACCTTTCTTTAGG + Intergenic
1120459914 14:84781623-84781645 TGCCATGTGGACCTGTCTATAGG + Intergenic
1121732603 14:96197005-96197027 GGCAATGTGGTCCTCTCTGGGGG + Intergenic
1122022845 14:98853765-98853787 CTCCATGTGGGCTTCTCTGTGGG - Intergenic
1122116544 14:99530439-99530461 GTCCACGTGGGCATCTCTGTTGG - Intronic
1122788428 14:104174459-104174481 GCCCATGTGGCCCTCCCTGGGGG + Intronic
1125968480 15:43893320-43893342 GACCAGGAGGCCCTCTCTGTTGG - Intronic
1126678455 15:51182126-51182148 GGCCATGTGGACTTTTCTGTAGG + Intergenic
1127879344 15:63142725-63142747 CACCACATGGACCTCTCTGTAGG + Intronic
1128869723 15:71144878-71144900 GTCCATGTGGACCAAAGTGTAGG + Intronic
1129157717 15:73729067-73729089 TTCCATGTGGAAATCTCTCTGGG + Intergenic
1129944682 15:79528372-79528394 TACCATGTGAACCTCTCTATAGG - Intergenic
1130961422 15:88661156-88661178 GCAAATGTGGACCTCTTTGTAGG - Intergenic
1133763527 16:8819259-8819281 GTCCATGTGGACCCATCTCTAGG + Intronic
1133971834 16:10573720-10573742 GTCCATGTGGTTGTCTCTGATGG - Intronic
1135303154 16:21347811-21347833 GCCCATGCGGAGTTCTCTGTTGG + Intergenic
1137656783 16:50166511-50166533 GGCCATGTGCACATCTTTGTTGG + Intronic
1138517492 16:57544359-57544381 GTGCATGGTGACCTCTCTGAAGG + Intronic
1140744543 16:77969511-77969533 TGCCATGTGGACCTCTCCATAGG + Intronic
1143765820 17:9137125-9137147 CTCCATGAAGACCTCTCTGATGG + Intronic
1145451120 17:23248764-23248786 GGCTATTTGGACCACTCTGTGGG + Intergenic
1145614338 17:25623482-25623504 GGACATGTGGACCTCTTTGAAGG + Intergenic
1145643418 17:26045889-26045911 GGACATGTGGACCTCTTTGAAGG + Intergenic
1147051485 17:37798176-37798198 CACCATGTGGACCTCTCCATAGG + Intergenic
1148168404 17:45500340-45500362 GTCCATGTGGACCCCTGACTAGG + Intergenic
1148280408 17:46342600-46342622 GTCCATGTGGACCCCTGACTAGG - Intronic
1148302636 17:46560537-46560559 GTCCATGTGGACCCCTGACTAGG - Intronic
1148623449 17:49051791-49051813 AACCAGGTGGACCTCTCTGAGGG - Exonic
1150399596 17:64846791-64846813 GTCCATGTGGACCCCTGACTAGG + Intergenic
1152401793 17:80070899-80070921 GTCCATCTGGGCCTGCCTGTGGG + Intronic
1168461452 19:56562441-56562463 TTCCATGTGGGCCTCTCTGTAGG + Intergenic
925147165 2:1588933-1588955 GTCCTCCTGGGCCTCTCTGTGGG - Intergenic
930174405 2:48286931-48286953 TGCTATGTGGACCTCTCTATAGG - Intergenic
930972290 2:57410315-57410337 GTCTTTGTGGACCACTCTCTTGG - Intergenic
932143453 2:69299006-69299028 TGCCATGGGGGCCTCTCTGTAGG - Intergenic
932720247 2:74133590-74133612 CACCACATGGACCTCTCTGTAGG + Intronic
932815815 2:74860979-74861001 CACCATCTTGACCTCTCTGTAGG + Intronic
934531464 2:95091916-95091938 TTCCACGTGTACCTCTCTCTAGG - Intronic
937014708 2:118594601-118594623 GTCAATGCTGACCTTTCTGTTGG - Intergenic
937908340 2:127063545-127063567 GGCCATGGGGACCCCTCTGAGGG - Intronic
944217896 2:197274134-197274156 GTCCATGTGGACATCACTAAGGG + Intronic
944584293 2:201159996-201160018 CTTCATGTGGGCCTCTCTGAGGG + Intronic
945988833 2:216376285-216376307 GTCCCTTTAGAGCTCTCTGTTGG - Intergenic
948480505 2:238247302-238247324 TGCCATGGGGACCTCTCCGTAGG - Intronic
1168995913 20:2133154-2133176 GTCCATGTGGACCTCTCTGTGGG + Intronic
1169067743 20:2703972-2703994 CTCCCTGTGGACCTCTCCATAGG + Intronic
1169649540 20:7851708-7851730 TTCAATGTGGACCTTTGTGTGGG - Intergenic
1170471682 20:16674268-16674290 CTCCATGTGGTCATCTCTATGGG - Intergenic
1172967029 20:38843468-38843490 TGCCATGTGGCCCTCTCTATAGG + Intronic
1173915740 20:46707703-46707725 CTCCATGTGGGCCTCTCCATTGG + Intergenic
1174141051 20:48413817-48413839 GTCCATGTGCAGCTCTGTGCAGG - Intergenic
1175390037 20:58621304-58621326 ATCCAGGTGGACCTATCTTTTGG - Intergenic
1175811825 20:61862416-61862438 GTCCATGAGGACCTCCTTGGCGG + Intronic
1175926030 20:62472076-62472098 GTCCACGTGGCCCTCACTGAGGG - Intronic
1180244557 21:46538380-46538402 GTGCATGTACACCTCTCTGTGGG + Intronic
1181392289 22:22592427-22592449 GTCCATATTGCCCTCTCTGTTGG - Intergenic
1181518297 22:23430489-23430511 CTCCATATGGACCTCTCCATAGG + Intergenic
1184278613 22:43424982-43425004 GTCCATGTGGCGCTCTAGGTGGG + Exonic
1184365471 22:44048322-44048344 GACCATGTGGACATATCTTTTGG + Intronic
949941805 3:9160443-9160465 CGCCACGTGGACCTCTCTATAGG - Intronic
953304692 3:41817129-41817151 GTTCATTTGGACCACTGTGTAGG - Intronic
954884707 3:53862341-53862363 TTCCATGTTGTTCTCTCTGTTGG - Intronic
957040992 3:75335470-75335492 TGCCTTGTGGACCTCTCCGTGGG - Intergenic
958178145 3:90023027-90023049 CACCATGTGGACCTCTCCATGGG - Intergenic
959288964 3:104448739-104448761 TGCCATGTGAACCTCTCTATAGG - Intergenic
959535682 3:107482497-107482519 TTCCAGGTGGACCTGTCTTTTGG + Intergenic
961213780 3:125144429-125144451 GTCCCTCTGGACCCCTCTGCAGG - Intronic
961221845 3:125207243-125207265 GTCCATGTGGACCCTTTTCTAGG - Intronic
967043050 3:185711586-185711608 TCCCATGTGCACCTCTCTGCTGG - Intronic
967980041 3:195060216-195060238 ATCCATGGGGACCCCTCTCTGGG + Intergenic
969272920 4:6115058-6115080 CCCCATGTGGACTTTTCTGTCGG - Intronic
971791294 4:31173149-31173171 GCCCATGAAGACCTCTCAGTGGG + Intergenic
978596164 4:110379551-110379573 GTCCATGTGGGCCGCTGTGCTGG - Intronic
979393803 4:120161234-120161256 GTCCACATGGACATCTCTGTAGG - Intergenic
980863778 4:138529931-138529953 GGCCATGTGGACCCCTTTTTGGG - Intergenic
981191715 4:141872262-141872284 GTCCCGGGGGACCTCTGTGTGGG + Intergenic
982857473 4:160403219-160403241 CACCATATGGATCTCTCTGTAGG - Intergenic
987211418 5:15687438-15687460 GTGCATGTGGGCCTCTTTGATGG - Intronic
990801475 5:59608953-59608975 TGCCATGTGGGCCTCTCTATAGG - Intronic
992009803 5:72514905-72514927 CTCCATGTGGATCTCTCCATGGG - Intergenic
992136094 5:73747585-73747607 GTCTAAGTGGGTCTCTCTGTTGG + Intronic
992364456 5:76077792-76077814 GTCCATGTGGATCTGGGTGTAGG + Intergenic
993656509 5:90584631-90584653 CTCCATGTGAGCCACTCTGTGGG + Intronic
993844416 5:92922736-92922758 GTGCCTGTGGAACTCTCTGCAGG + Intergenic
994551995 5:101246567-101246589 TGCCATATGGACCCCTCTGTGGG + Intergenic
995261788 5:110112854-110112876 GGCCATGTGGTCCTCTCCATAGG + Intergenic
995528378 5:113068722-113068744 CACCATGTGGACCTCTCCATAGG - Intronic
999416053 5:151397057-151397079 GTCCACATGGACTTCTCTGTAGG + Intergenic
999500415 5:152141486-152141508 CCCCAAGTGGACCTCTGTGTTGG + Intergenic
999757561 5:154676275-154676297 TACCACGTGGACCTTTCTGTTGG - Intergenic
1001298164 5:170513862-170513884 GTCTAGTAGGACCTCTCTGTTGG + Intronic
1002161643 5:177317488-177317510 GCCCATGTGGACCTATTAGTGGG + Intergenic
1003749807 6:9042631-9042653 TTCCATGTGGACCTCTGAGCAGG + Intergenic
1003865860 6:10361979-10362001 GTCCAGGTGGATTCCTCTGTTGG + Intergenic
1004260643 6:14104604-14104626 TTACATGTATACCTCTCTGTAGG - Intergenic
1004339370 6:14794809-14794831 TTCCATGCGGACGTCCCTGTGGG - Intergenic
1007707085 6:43797703-43797725 GTACATGGGCCCCTCTCTGTGGG + Intergenic
1011237728 6:85236295-85236317 TTCCATGTGAGACTCTCTGTAGG - Intergenic
1011337378 6:86276077-86276099 GTCCATGATGGCCTCTCTGTTGG + Intergenic
1016626421 6:146174922-146174944 TGCCATGTGGACCTCTGTGTGGG + Intronic
1018415910 6:163601891-163601913 GAGGATGTGGACCTCTCTGGGGG + Intergenic
1018612532 6:165660274-165660296 GAGCATGTGGCCTTCTCTGTTGG - Intronic
1019955685 7:4412560-4412582 CTCCATGTGGGCCAGTCTGTGGG + Intergenic
1021645537 7:22786087-22786109 TGCCATGTGGACCTCTCCATAGG - Intergenic
1023063292 7:36350492-36350514 GCCAATGAAGACCTCTCTGTGGG - Intronic
1023720475 7:43088414-43088436 TGCCATGCAGACCTCTCTGTAGG - Intergenic
1023822314 7:43987000-43987022 GGCCATGTGGACCACTCAGGTGG - Intergenic
1024224905 7:47319127-47319149 GTCCATGTGCACCGCTATATAGG + Intronic
1026595569 7:71731725-71731747 CACCATGTGGGCCTCTTTGTAGG + Intergenic
1028087588 7:86655333-86655355 ATCCATGTGGTCCTTACTGTAGG + Intronic
1030310068 7:108059995-108060017 GCACATTTGGATCTCTCTGTGGG + Intronic
1035125491 7:156605680-156605702 CTCCAGGGGGACCTCTCTGCTGG - Intergenic
1037252636 8:16914791-16914813 GTCCTTGTGGACCTCAGGGTTGG - Intergenic
1038425813 8:27463142-27463164 GGTCATGTGGCCCCCTCTGTGGG - Exonic
1039450033 8:37665479-37665501 CTCCATGTGGGCCTCTCTGCAGG - Intergenic
1040335912 8:46415872-46415894 GGCCATGGGGACTTCTGTGTTGG - Intergenic
1042502986 8:69529734-69529756 TGCCATGTGGACCTCTCCATGGG + Intronic
1045271558 8:100666408-100666430 GTCCAACTGGACATCTATGTGGG + Intergenic
1046002066 8:108433146-108433168 CGCCACATGGACCTCTCTGTGGG + Intronic
1048326795 8:133446015-133446037 GTCCATATGGTCCTCTCTGTGGG + Intergenic
1050159661 9:2704586-2704608 CTCCATGTGGACCTCTCTGTAGG + Intergenic
1050192763 9:3045677-3045699 GTCCATGTGGACATCTTGGTGGG - Intergenic
1054707603 9:68478854-68478876 TTCCAGGTGGACATATCTGTTGG + Intronic
1057132628 9:92664669-92664691 TTCCCTGTGGCCCTCACTGTGGG - Intronic
1057281481 9:93715201-93715223 GCTCATGTGGGCCTCTTTGTGGG + Intergenic
1057694461 9:97313432-97313454 GCCCCTGAGGACCTCTCTGCTGG - Intronic
1057706381 9:97398037-97398059 TGCCATGTGGGCCTCTATGTCGG - Intergenic
1058967021 9:110048321-110048343 GTGCATGTGGACGTGTGTGTTGG - Intronic
1059100956 9:111470881-111470903 GGCCTTGTGGACCTCAGTGTTGG - Intronic
1060635376 9:125195864-125195886 CCCCATATGGACCCCTCTGTGGG + Intergenic
1061058230 9:128236044-128236066 ATCCTTGTGGTCCTCTCTTTGGG + Intronic
1061807900 9:133146793-133146815 TGCCATGTGGGTCTCTCTGTAGG - Intronic
1062154216 9:135037394-135037416 GGCCATGTGGCTCTCTGTGTGGG - Intergenic
1062327836 9:136020777-136020799 GGCCATGTGGGTCTGTCTGTGGG - Intronic
1186962149 X:14748212-14748234 TGCTATGTAGACCTCTCTGTAGG - Intergenic
1187204975 X:17173408-17173430 TGCCAGGTGGCCCTCTCTGTAGG + Intergenic
1189806522 X:44741022-44741044 CGCCATATGGACCCCTCTGTAGG - Intergenic
1192263863 X:69525247-69525269 GTCCCTGTGGAATTCTCTCTGGG - Intronic
1194953902 X:100156817-100156839 CGCCATATGGACCCCTCTGTAGG + Intergenic
1195907591 X:109860951-109860973 TACCATGTGGACCTCTCCATAGG - Intergenic
1196096507 X:111806493-111806515 TGCCATGTGGGCCTCTCTGCAGG + Intronic
1196304691 X:114087401-114087423 GTCCCTGTGGACCACCCTGAGGG + Intergenic
1196352469 X:114747736-114747758 TGCCATGTGGGCCTCTCTATAGG - Intronic
1197646288 X:129021204-129021226 TGCCATGTGGCCCTCTCTGAAGG - Intergenic
1198068781 X:133127298-133127320 CTCCATGTGGGCCTGTCTATGGG + Intergenic
1200121408 X:153792727-153792749 GTCCATCTGGAGCGCTCTCTGGG - Intronic
1200171182 X:154076325-154076347 GCCCCTGTTGACCTCTCTGATGG + Intronic