ID: 1168996363

View in Genome Browser
Species Human (GRCh38)
Location 20:2136100-2136122
Sequence CAGGGGACACATTCTGAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 210}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168996361_1168996363 -10 Left 1168996361 20:2136087-2136109 CCTAACTTAGACTCAGGGGACAC 0: 1
1: 0
2: 0
3: 9
4: 122
Right 1168996363 20:2136100-2136122 CAGGGGACACATTCTGAGGCCGG 0: 1
1: 0
2: 0
3: 32
4: 210
1168996355_1168996363 30 Left 1168996355 20:2136047-2136069 CCAGTCATAAGTCTACTCTTTTC 0: 1
1: 0
2: 0
3: 14
4: 163
Right 1168996363 20:2136100-2136122 CAGGGGACACATTCTGAGGCCGG 0: 1
1: 0
2: 0
3: 32
4: 210
1168996356_1168996363 2 Left 1168996356 20:2136075-2136097 CCTCTTACCATACCTAACTTAGA 0: 1
1: 0
2: 0
3: 7
4: 99
Right 1168996363 20:2136100-2136122 CAGGGGACACATTCTGAGGCCGG 0: 1
1: 0
2: 0
3: 32
4: 210
1168996358_1168996363 -5 Left 1168996358 20:2136082-2136104 CCATACCTAACTTAGACTCAGGG 0: 1
1: 0
2: 1
3: 3
4: 73
Right 1168996363 20:2136100-2136122 CAGGGGACACATTCTGAGGCCGG 0: 1
1: 0
2: 0
3: 32
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168996363 Original CRISPR CAGGGGACACATTCTGAGGC CGG Intronic
902221496 1:14968736-14968758 CAGGTGACTCACTCTGTGGCAGG - Intronic
902760378 1:18576951-18576973 CAGGGACAACTTTCTGAGGCCGG - Intergenic
903561980 1:24235014-24235036 CAGGGGACACTTGACGAGGCTGG + Intergenic
904995016 1:34624955-34624977 CAAGGGAAAGATCCTGAGGCTGG + Intergenic
905447141 1:38034798-38034820 CATGGGACTCTTTGTGAGGCTGG + Intergenic
906487809 1:46245298-46245320 CAGGGAACAGAGTTTGAGGCAGG - Intergenic
906536288 1:46552569-46552591 CCGGGGCCATATTCTGAGACTGG - Intergenic
906777242 1:48540861-48540883 GAGGGGAGAAATTCTGTGGCAGG - Intronic
908473789 1:64470018-64470040 CGGGGGGCAGGTTCTGAGGCGGG + Intergenic
908746401 1:67380947-67380969 ATGAGGTCACATTCTGAGGCTGG + Intronic
910901422 1:92125452-92125474 CAGGGAACACTTTGAGAGGCTGG + Intronic
912253738 1:108037987-108038009 CAGAGCACAAATTCTGAAGCCGG + Intergenic
912522355 1:110254312-110254334 CAGGGGTCAGATCCTGTGGCTGG - Intronic
913316908 1:117561353-117561375 CAGAGCACCCATTCTGAGACTGG - Intergenic
914513411 1:148353825-148353847 CAGGGGACGCATTGCGAGGCCGG - Intergenic
914513426 1:148353883-148353905 TAGGGGACGCATTGCGAGGCCGG - Intergenic
915022492 1:152794597-152794619 TAGGAGACACACTCTGAGACAGG - Intronic
915023233 1:152801813-152801835 TAGGAGACACACTCTGAGACAGG - Intronic
915075076 1:153301382-153301404 CAGGTGACATATCATGAGGCTGG + Intronic
915676811 1:157539559-157539581 CAGTGGACAAATTTTGAGGGAGG - Intronic
915686610 1:157640498-157640520 CAGTGGACAAATTTTGAGGGAGG - Intergenic
917669356 1:177257568-177257590 CAGAGCACCCACTCTGAGGCAGG + Intronic
919930119 1:202215650-202215672 CGGAAGACAGATTCTGAGGCAGG - Intronic
921811025 1:219514619-219514641 CAGGGTACACATTTTGTTGCAGG + Intergenic
922404502 1:225298337-225298359 CAGCTGACACATTCTTGGGCTGG - Intronic
923397619 1:233582624-233582646 CAGGGGACTCATTCTCAGCTGGG + Intergenic
924251770 1:242140345-242140367 TAAGGGATACTTTCTGAGGCTGG + Intronic
1062826355 10:571583-571605 CAGCTGACACATTCTCAGTCAGG + Intronic
1064308706 10:14191733-14191755 CAGGGAATATATTCTGAGGCTGG - Intronic
1065770275 10:29071730-29071752 CTGGGGACACATTCAGAAGCTGG - Intergenic
1067530298 10:47066256-47066278 CAGGGGACACCTGTGGAGGCTGG - Intergenic
1069703023 10:70440360-70440382 CAGGGGACACCCTCGGGGGCGGG - Intronic
1069758055 10:70785738-70785760 CTGGGGACCCATTCTCAGGGAGG + Intergenic
1072255872 10:93619720-93619742 AAAGGTTCACATTCTGAGGCTGG - Intronic
1074941668 10:118241865-118241887 CAGGGGAAAGATTCTGTGGCAGG + Intergenic
1075275498 10:121089396-121089418 CAGGGGACAAACTCTGAGCCAGG + Intergenic
1075701149 10:124470137-124470159 GAGGGGAGCCATTCAGAGGCAGG + Intronic
1076003723 10:126931670-126931692 CAGGGAAGCCATTCTGAAGCGGG + Intronic
1076288707 10:129326998-129327020 CAGGGGACCCATTCTGGTACTGG + Intergenic
1078748484 11:14137829-14137851 CAGAGGCCAGATTCAGAGGCTGG - Intronic
1079468772 11:20758311-20758333 CACAGGACACATTCTGAATCAGG - Intronic
1081577795 11:44330045-44330067 CAGGGACCACAGGCTGAGGCTGG + Intergenic
1081657673 11:44868174-44868196 CAGGGGACGCAGTTGGAGGCTGG + Intronic
1083477850 11:62925678-62925700 TGGGGCACACATTCTGAGTCCGG + Intergenic
1083544076 11:63536171-63536193 AAGGGGAGGCATTCGGAGGCAGG - Intergenic
1085312528 11:75525112-75525134 CAGGGGAAACAAGCAGAGGCTGG - Intronic
1085506817 11:77065714-77065736 AAGGTGAGACATTTTGAGGCAGG - Intergenic
1087277647 11:96176446-96176468 CAGGGGACTCATCTTGAGGTAGG + Intronic
1087289488 11:96304169-96304191 CAGTGTACAGATTCTGAGGAGGG + Intronic
1088656479 11:112004633-112004655 CAGTGGACTGCTTCTGAGGCAGG + Intronic
1089130889 11:116211078-116211100 CAGGGGACACCTTCTTGGGTTGG - Intergenic
1089897708 11:121948350-121948372 CAGAGGAGACATTTTGAGCCTGG - Intergenic
1089928145 11:122280852-122280874 CAGGGAACAGATTCTGACCCTGG + Intergenic
1091171227 11:133521315-133521337 CAGGGGCCACATCCTGGGTCAGG + Intronic
1091835433 12:3582610-3582632 CTGGGGGCAAATTCTGAGGGGGG - Intronic
1093181546 12:15972582-15972604 CCTGGGACACATCATGAGGCAGG - Intronic
1095353606 12:41244601-41244623 CATGGGCAACACTCTGAGGCGGG - Intronic
1095396658 12:41769799-41769821 CAGGTGACATGTTCTGTGGCAGG + Intergenic
1096503696 12:52080386-52080408 CAGGAGACACAATCCGGGGCGGG - Intergenic
1096963775 12:55607858-55607880 CAGGGGATCAATTCAGAGGCGGG - Intergenic
1097011037 12:55953653-55953675 AAGGGAGCACATTCAGAGGCAGG - Intronic
1102359637 12:112273547-112273569 CTGGTGACACATTCTGGGGTTGG + Intronic
1103557848 12:121776564-121776586 CAGGGGCCGCACCCTGAGGCGGG + Exonic
1104341057 12:127949071-127949093 CAGAGGACACATGCTTTGGCTGG + Intergenic
1104744086 12:131200051-131200073 CAGGGTTCACATCCTGGGGCTGG - Intergenic
1104847848 12:131855752-131855774 CAGCGGGCACACTCTGAGGTCGG + Intergenic
1105211864 13:18261723-18261745 GTGGGGACACATTCTGAGCGTGG - Intergenic
1107477701 13:40755559-40755581 CAGTGCCAACATTCTGAGGCAGG + Intronic
1107986927 13:45783860-45783882 CAAGGGACACATGCACAGGCAGG + Exonic
1113037040 13:106062007-106062029 CAGGGAGCACAGCCTGAGGCAGG - Intergenic
1113608112 13:111624740-111624762 CAGGGGATACTTTCTGAGTGTGG + Intronic
1113721237 13:112558907-112558929 CAGGGGACAGACACTGAGCCCGG + Intronic
1114033750 14:18601106-18601128 CAAGGGACACATTATCAGTCAGG - Exonic
1114078540 14:19180280-19180302 CAAGGGACACATTATCAGTCAGG - Intergenic
1114124897 14:19713905-19713927 CAAGGGACACATTATCAGTCAGG + Intergenic
1115490106 14:33950725-33950747 CCTGGGACACATCATGAGGCTGG - Exonic
1119351942 14:73973072-73973094 AAGGGGACACTCTCTGAGGCAGG + Intronic
1119955764 14:78797134-78797156 CAGGGGAACCTTTCTGAGGGGGG + Intronic
1120769761 14:88366175-88366197 CAGTGGACAAATTGTGAGGCAGG + Intergenic
1121731775 14:96192477-96192499 CAGGGGACCAACTCTGGGGCAGG + Intergenic
1122863251 14:104591895-104591917 CAGAGGACTCGTTCTGGGGCGGG - Intronic
1124227037 15:27903391-27903413 CAAGCGACACTTTCTGAGGCAGG - Intronic
1126020342 15:44394306-44394328 CAGGGGATACATTCTGAGAAAGG + Intronic
1126968659 15:54084516-54084538 AAGGGGACACATTCAGACCCAGG - Intronic
1128318689 15:66677879-66677901 CAGGGGACACATTTGGAGGTTGG + Intronic
1128536437 15:68494182-68494204 CAGAGGAAGCATTCTGAGGAAGG - Intergenic
1129888578 15:79056045-79056067 CAGGGAGCACCCTCTGAGGCAGG + Intronic
1130075989 15:80690853-80690875 CAGAGGACACAGTGTGATGCTGG + Intronic
1131580505 15:93638318-93638340 AAGGTGACACATTCTGAGTATGG - Intergenic
1135854324 16:25992965-25992987 TAGGGGGCCCATTCTTAGGCAGG + Intronic
1137025193 16:35466975-35466997 CAAGGGACACATGCTTTGGCTGG - Intergenic
1137237829 16:46629786-46629808 CAGGAGACAGAATCTCAGGCAGG + Intergenic
1137524724 16:49224667-49224689 AAGGGGACACATACTAGGGCCGG - Intergenic
1139526807 16:67521721-67521743 CTGGGGACACCGCCTGAGGCTGG - Intronic
1140347927 16:74233260-74233282 GAGGGGACACATTCATAGTCAGG - Intergenic
1141451515 16:84106731-84106753 AAGGGGGCACAGGCTGAGGCAGG + Intronic
1142000450 16:87661334-87661356 AAGGGGACACATTCACAGACGGG + Intronic
1142132229 16:88436337-88436359 CAGGGCCCACAGGCTGAGGCCGG - Exonic
1142962526 17:3559545-3559567 CAGGGGACACAGGCTCAGGCAGG + Intergenic
1143751114 17:9028453-9028475 CAGGGGAAACCTTCTGGGGTGGG + Intronic
1144519857 17:15946117-15946139 CAGCAGACACGTTCTGAAGCTGG - Intronic
1145785416 17:27590737-27590759 CATGGGAAACCTTCTGTGGCTGG + Intronic
1147575499 17:41596558-41596580 CAGGGCCCACATTCTGTGGCTGG + Intergenic
1147879435 17:43644416-43644438 CAGGGGACACACTCTGTGCCAGG + Intronic
1149520911 17:57317806-57317828 CAAGAGGCACATTCTGAGGCTGG - Intronic
1150430104 17:65108393-65108415 CAGTGGTCTCATTCTGAGGACGG + Intergenic
1152188722 17:78875281-78875303 CAAGGGACAGATGCTGAGGAAGG + Intronic
1158042986 18:53119364-53119386 CCAGGAACACATTCTGAGGGAGG - Intronic
1158050737 18:53215558-53215580 CCAGGGAGACGTTCTGAGGCGGG - Exonic
1161016372 19:1985700-1985722 CTGGGGCCCCATTCTGCGGCAGG + Exonic
1161687691 19:5711487-5711509 CAGGGGACACGGGCTGGGGCTGG + Intronic
1162327339 19:10006990-10007012 CAGAGGAGACATTCAGAGGGAGG - Intronic
1163316650 19:16545058-16545080 CAGGGGACTCAGTCTATGGCGGG + Intronic
1164509168 19:28883419-28883441 CAGAGAACACACACTGAGGCAGG - Intergenic
1164743430 19:30593974-30593996 CATGGGACAGACTCTGAGGCTGG - Intronic
1164937891 19:32229280-32229302 CTGAGGACACAGTCCGAGGCAGG + Intergenic
1165782467 19:38442339-38442361 CGGGGGGCACATTCTGGGGTGGG - Exonic
1168313526 19:55473507-55473529 CAGGGCTCAGAGTCTGAGGCTGG + Intergenic
931746354 2:65294854-65294876 AAGGGCAAACATTCTGAGGCAGG + Intergenic
932781903 2:74564222-74564244 CACGGGACACATGCTGGGGTGGG + Intronic
934301762 2:91780750-91780772 GTGGGGACACATTCTGAGCATGG + Intergenic
937341791 2:121095936-121095958 CTGGGGAACCAGTCTGAGGCCGG + Intergenic
937909498 2:127068659-127068681 CAGGAGGCCCATTCTCAGGCTGG + Intronic
937964628 2:127493937-127493959 CAGGGGAAACTATCTGTGGCAGG - Intronic
939781050 2:146448200-146448222 CAGGGCACAGGTTCTGAGACAGG + Intergenic
939826845 2:147025364-147025386 CTGCAGACTCATTCTGAGGCTGG - Intergenic
942613472 2:177765477-177765499 CAGTGGTCACATTTTAAGGCAGG - Intronic
946067969 2:217006365-217006387 CAGGGGGCTCCTGCTGAGGCTGG - Intergenic
946272541 2:218606253-218606275 AAGGGGACACATTAGGAGGGAGG - Intergenic
1168996363 20:2136100-2136122 CAGGGGACACATTCTGAGGCCGG + Intronic
1169030777 20:2405237-2405259 CATGGTGCACATTCTGAGCCAGG - Intronic
1170849632 20:19993394-19993416 AAGGGGGCACATTCTGGGGGTGG - Intronic
1172204846 20:33155954-33155976 CAGGGCACAAATTCTGTGTCAGG - Intergenic
1174077451 20:47948091-47948113 CAGAGGTCCCAGTCTGAGGCAGG + Intergenic
1175038892 20:56026993-56027015 CTTGGCACACATTCTGTGGCTGG + Intergenic
1175763860 20:61579623-61579645 CAGGGAACACAACCTGGGGCTGG - Intronic
1175788901 20:61729373-61729395 GAAGGGCCACATTCTGAGGCAGG - Intronic
1177460303 21:21400171-21400193 AAGGTGACACATTCAGATGCTGG + Intronic
1179495983 21:41771659-41771681 CAGGGGACAGAGTCACAGGCAGG - Intergenic
1180457866 22:15528148-15528170 CAAGGGACACATTATCAGTCAGG - Exonic
1180814669 22:18781969-18781991 GTGGGGACACATTCTGAGCGTGG - Intergenic
1180877132 22:19179782-19179804 CAGGGGACGCAATGGGAGGCAGG - Exonic
1181048827 22:20229113-20229135 CAGGGGACACAGGCTGGGGGAGG + Intergenic
1181053652 22:20249250-20249272 CTGGGGACGCACTCTGAGCCAGG + Intronic
1181200858 22:21216305-21216327 GTGGGGACACATTCTGAGCATGG - Intronic
1181700887 22:24620668-24620690 GTGGGGACACATTCTGAGCGTGG + Intronic
1182737184 22:32539267-32539289 CAGGTGAACCATTCTGAGACTGG + Intronic
1183395582 22:37569105-37569127 CAAAGGACACACTGTGAGGCTGG - Exonic
1183950666 22:41351009-41351031 CAGTGGCAACAGTCTGAGGCTGG + Intronic
1184766682 22:46576142-46576164 CAGGGGACCCAGTCTGGGGAGGG + Intronic
1184777619 22:46631373-46631395 CAGGAGTCACATTCAGAGACAGG - Intronic
1203226061 22_KI270731v1_random:79130-79152 GTGGGGACACATTCTGAGCGTGG + Intergenic
1203264766 22_KI270734v1_random:7656-7678 GTGGGGACACATTCTGAGCGTGG - Intergenic
952572386 3:34732348-34732370 CAGGTGACACCTTCTGATGCAGG + Intergenic
955471593 3:59292095-59292117 CATGGGACAGATTCAGAGTCAGG + Intergenic
955795912 3:62636860-62636882 CAGAGGACATATTCTGAGGGTGG - Intronic
956773883 3:72549355-72549377 TTGGGGTCACATTCTGAGCCTGG + Intergenic
960427213 3:117523605-117523627 TAGGGGACAGTTTCTGAGTCAGG + Intergenic
960441242 3:117691723-117691745 CTGGGGAGACCTACTGAGGCAGG - Intergenic
962893272 3:139691891-139691913 CAGGGCACAGATTCCCAGGCTGG - Intergenic
964811084 3:160665385-160665407 GAGGGGACACAGTCTGGGGATGG + Intergenic
966883070 3:184360760-184360782 CAGGGGACACACCCTGGGGTGGG + Intronic
968506818 4:974552-974574 CCGGGGACCCAGTCTGAGGAGGG + Intronic
968618807 4:1594318-1594340 AAGGGGACACAGGCTGGGGCAGG - Intergenic
968957183 4:3725387-3725409 CAGGGGGCACATTCCGGGGCTGG + Intergenic
969444201 4:7234868-7234890 CAGGGGACAGACTCAGGGGCAGG + Intronic
970974131 4:22023413-22023435 CTGGGGACACAGGTTGAGGCTGG + Intergenic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
978597318 4:110392313-110392335 CAGGGGAGACATTCTGAAGATGG + Intronic
979913600 4:126403750-126403772 CAAGAGACACATTCTGATTCAGG - Intergenic
981153102 4:141401686-141401708 CAGGGGACACAAACTGACACAGG + Intergenic
981325241 4:143438828-143438850 AAGGGCACACTTCCTGAGGCAGG - Intronic
982435866 4:155383285-155383307 CAGAGGACACATGCTCAGGCCGG + Intergenic
982463597 4:155702552-155702574 CAGAGGGCAGATTCTGAGTCGGG - Intronic
983857774 4:172666914-172666936 CAGGAGGCAGATTCTGAGGAGGG + Intronic
984951525 4:185011345-185011367 CAGGGGGTGCAATCTGAGGCCGG + Intergenic
985043496 4:185916654-185916676 CAGGGGACATTTTCTGTGTCTGG + Intronic
985992923 5:3578212-3578234 CACAGGACACTTTCTGAGGAGGG - Intergenic
986039085 5:3969476-3969498 CAGGGGAGACAGTAGGAGGCAGG + Intergenic
986209533 5:5657597-5657619 CAGGTGACAGATTCTGATGCAGG - Intergenic
986928156 5:12783967-12783989 CAGTGGGCTCATTCTTAGGCAGG - Intergenic
992176460 5:74154091-74154113 GAGGGGACACAAATTGAGGCAGG + Intergenic
992610486 5:78504321-78504343 CAGGAGAAAAATTCTGAGGCAGG + Intronic
997337287 5:133117295-133117317 CAGGGCACACATGCTCAGGCAGG + Intergenic
997376794 5:133403282-133403304 CAGGGCACACGCTCTGAAGCAGG - Intronic
999687664 5:154117195-154117217 CAGGGGACCCATGCTGAGGAGGG + Intronic
1002667354 5:180834882-180834904 CAGGGGACACATTCAGATCATGG + Intergenic
1003779726 6:9411276-9411298 TGGGGGACACATTCAGAGGATGG - Intergenic
1006716817 6:36125686-36125708 GAGGGGACACCTTCTGGGGCAGG + Intergenic
1007618726 6:43198628-43198650 CAGGGGACCCATCCTGACCCTGG - Exonic
1009840362 6:69064688-69064710 CAGAGTACACATTCTGATACTGG - Intronic
1010967037 6:82222699-82222721 CAGGTGACACATTATGAGTATGG + Intronic
1013813011 6:114065815-114065837 CAGGGGACCAATTCAGAGGAAGG + Intronic
1015035135 6:128644522-128644544 CAGGGAAATCATTCAGAGGCAGG + Intergenic
1017179836 6:151540857-151540879 CAGGGGGCACAGTCAGAGGCAGG - Intronic
1017357279 6:153524465-153524487 CAGAGGCCATATTCTGGGGCAGG - Intergenic
1017451881 6:154561998-154562020 CAGTGGACACCTTGTGATGCTGG - Intergenic
1017694240 6:156998631-156998653 CAGTGGACTCATCCTGAGGCTGG + Intronic
1019534105 7:1519112-1519134 CTGGGGACCCCTTCTGTGGCTGG + Intergenic
1020126275 7:5534057-5534079 CAGGTGATAAATTCTGAGGAGGG - Intronic
1021543395 7:21785998-21786020 CAGGGCAAACACTTTGAGGCAGG - Intronic
1022834731 7:34102739-34102761 CAGGGGACACATTATGATCAGGG + Intronic
1024633900 7:51271127-51271149 CAGGTGACACGCACTGAGGCTGG - Intronic
1025986332 7:66455734-66455756 CAGGAGCCAAACTCTGAGGCAGG + Intergenic
1026028598 7:66768928-66768950 CAGGAGCCAAACTCTGAGGCAGG - Intronic
1026889704 7:73974782-73974804 CTGGGGACACAGTCTTAGACCGG - Intergenic
1030630886 7:111894541-111894563 CAGGGGACAGTTTCTGAGGGAGG + Intronic
1030891086 7:115000368-115000390 ACAGGGACACATTCTGAGGAAGG - Intronic
1035181219 7:157090791-157090813 CAGGGGACGCAGGCTGAGACAGG + Intergenic
1035417745 7:158704400-158704422 GAGGGGACACTCTCTGAGGACGG + Intronic
1037903623 8:22702819-22702841 CAGGGGCTAGATGCTGAGGCAGG - Intergenic
1038217774 8:25578456-25578478 CAAGGGACAGATTCTTGGGCTGG - Intergenic
1040584732 8:48728064-48728086 CAGGAGACACATGCTAGGGCTGG + Intronic
1040725835 8:50379984-50380006 CAGAGCACACATGCTGAGGATGG + Intronic
1042021998 8:64378296-64378318 CAGTGGCCACAGTCTGGGGCTGG - Intergenic
1047027371 8:120838735-120838757 CAGGAAACACTTTCTAAGGCTGG - Intergenic
1047348344 8:124049865-124049887 CAGGAGACACATTCAGATGTGGG - Intronic
1047599855 8:126415042-126415064 AAGGGGAAACATTCTCAGGAAGG + Intergenic
1047757027 8:127926697-127926719 CCGGGGACAGATCCTGAGGAGGG - Intergenic
1048568538 8:135629964-135629986 GAGGGGAAACATTCTGCTGCTGG + Intronic
1048681948 8:136852751-136852773 CTGGGGAGACATTAAGAGGCAGG + Intergenic
1049318919 8:141985545-141985567 CAGGGGATACACTATGATGCAGG - Intergenic
1050756802 9:9014665-9014687 CATGGGAGACAATCTGAGGAAGG + Intronic
1051103468 9:13549809-13549831 CAGAGGTCAGAATCTGAGGCAGG + Intergenic
1053417953 9:37958633-37958655 CAGGGGACAGGTCCTGGGGCTGG + Intronic
1055599206 9:77897775-77897797 CAGGGGCCACAATGTGAGGCTGG + Intronic
1056687388 9:88777945-88777967 CAGGAGGCAAACTCTGAGGCCGG + Intergenic
1057533493 9:95875783-95875805 CAGGGGACGCTGTGTGAGGCTGG - Exonic
1059180930 9:112211404-112211426 CAGGGGAAAGAATCTGGGGCTGG + Intergenic
1059334087 9:113557765-113557787 CTGGGGAAAGTTTCTGAGGCAGG + Intronic
1060209284 9:121700047-121700069 CTGGGGGCACAGCCTGAGGCTGG + Intronic
1060395100 9:123310757-123310779 CAGGGGACTGAGGCTGAGGCAGG - Intergenic
1061630660 9:131870283-131870305 CAAGGGACAGATCCAGAGGCTGG - Intronic
1185659276 X:1714123-1714145 CAGGGGACAGATTCAGGGCCAGG + Intergenic
1188886548 X:35558093-35558115 CAGAGCACACATTCTGAGAATGG - Intergenic
1190297960 X:49039579-49039601 CAGGGGTCACAGTCTGATGGGGG + Intronic
1194049645 X:89053233-89053255 CAGAAGACACATATTGAGGCTGG - Intergenic
1195324647 X:103748371-103748393 CAGGGTACCCATTCCTAGGCTGG - Intergenic
1198890084 X:141384560-141384582 AAGGGTACACAATCTCAGGCAGG + Intergenic
1199601961 X:149546360-149546382 CAGGGGACAGATGCTGATGTCGG - Intronic
1199648425 X:149933124-149933146 CAGGGGACAGATGCTGATGTCGG + Intronic
1199856825 X:151766058-151766080 CAGGGGACAGACTTTGAGGAGGG - Intergenic
1200068219 X:153515076-153515098 CAGGGGAGAAAATCTGAGGCAGG - Intergenic