ID: 1168998978

View in Genome Browser
Species Human (GRCh38)
Location 20:2153202-2153224
Sequence AAATGCTGCAGAGCCCGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 93}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168998973_1168998978 12 Left 1168998973 20:2153167-2153189 CCTATTAACATCTTCTAATTCTA 0: 1
1: 0
2: 3
3: 27
4: 297
Right 1168998978 20:2153202-2153224 AAATGCTGCAGAGCCCGCTTTGG 0: 1
1: 0
2: 1
3: 4
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168998978 Original CRISPR AAATGCTGCAGAGCCCGCTT TGG Intronic
904353967 1:29926637-29926659 ATAGGCTGCAGAGCCTGCTCTGG + Intergenic
904704864 1:32382261-32382283 AAATGCTACAAAGCCAGCCTAGG + Intronic
906789184 1:48643775-48643797 AAAAGAAGCAGAGCCCGTTTGGG + Intronic
911370083 1:96986308-96986330 TAATTCTGCAGAGCCCATTTGGG - Intergenic
912262132 1:108121236-108121258 AATTACTGCATAGCCCTCTTAGG + Intergenic
912461434 1:109834797-109834819 AGGTGCTGCAGACCCCGCTTTGG + Intergenic
916019175 1:160777660-160777682 GTATGCTGCAGAGCCCCCTACGG - Intergenic
916195751 1:162220565-162220587 GAATGCTGCAGATCCCACATGGG - Intronic
916290771 1:163164051-163164073 GAAATGTGCAGAGCCCGCTTGGG + Intronic
922211244 1:223488406-223488428 ACATGCTCCAGAGCCTGCTGAGG - Intergenic
923507025 1:234612709-234612731 AACTGCTGCAGCAGCCGCTTTGG - Intergenic
924743843 1:246814403-246814425 AAATGCTGAAGATCCAGCTTTGG + Intergenic
1072467792 10:95682653-95682675 AAATGCTGCAGTGCCTGTTGAGG + Exonic
1073481033 10:103786208-103786230 ATGTGCTGCAGAGCCAGCCTGGG - Intronic
1075231342 10:120681371-120681393 TAATGCTCCAGAGGCCGTTTTGG - Intergenic
1076833491 10:133008463-133008485 TACTGCTGCAGAGCCCGATCTGG + Intergenic
1077744242 11:4882709-4882731 AAGTGCTACAGAGCACCCTTGGG - Exonic
1078067500 11:8087977-8087999 AAATGCAGCTGTGCCCTCTTAGG + Intronic
1078926016 11:15875821-15875843 AAATCCTGCAGAGCCAGGTCTGG - Intergenic
1080453683 11:32399655-32399677 AAAAGCTGCACAGCCCGCCCTGG + Intronic
1085733298 11:79017767-79017789 AAATGCGGCACAGGCTGCTTAGG + Intronic
1089286117 11:117409236-117409258 GAATGCTGCAGAGCACTCTACGG + Intronic
1102418131 12:112782129-112782151 AAATGCTGAAGGGCCTGCATGGG - Intronic
1104886628 12:132113569-132113591 AGATGCTGCAGATCCCTCTGAGG + Intronic
1117713777 14:58559825-58559847 AAATGCTCCACAGCCAGATTTGG - Intergenic
1122720347 14:103718372-103718394 AAATGCTGCAAAACCCCCTGGGG + Intronic
1127242216 15:57129113-57129135 AAATGGTGCAGAGCCACTTTGGG - Intronic
1128331620 15:66759959-66759981 AAAGTCTGCAGAGGCCGCCTGGG - Intronic
1131346857 15:91657430-91657452 ATATTCTGCAGAGTCAGCTTTGG - Intergenic
1131417574 15:92273880-92273902 ACCTGCAGCAGAGCCCGCCTGGG + Intergenic
1137929383 16:52572350-52572372 ATATGCTGCAGAACTGGCTTTGG - Intergenic
1138069935 16:53982661-53982683 AACAGCTGCAGAGCCCAGTTAGG - Intronic
1138574719 16:57900382-57900404 AAGTCTTGCAGAGCCTGCTTGGG + Intronic
1143851219 17:9813469-9813491 AAATGCTGCAGAGGCCGCTGTGG - Intronic
1146055211 17:29577545-29577567 AAATGCTGGAGAGCTGGCTCAGG + Intronic
1147657972 17:42101732-42101754 CATTGCTGCAGTGCCCGGTTTGG - Exonic
1148062198 17:44844567-44844589 CAGTGCTGCAGAGCCCCTTTAGG + Intergenic
1149268732 17:54954502-54954524 AAACTCTGCAGAGCCAGCTGTGG - Intronic
1157429157 18:47609192-47609214 AAATGTTTCACAGCCCTCTTTGG + Intergenic
1161950909 19:7467374-7467396 AGAAGCTGCAGAGCCAGCTGCGG + Exonic
1164591050 19:29507173-29507195 AAATGGTGCAGAGCCGGCTCTGG + Intergenic
925396383 2:3536482-3536504 AAATCCTGCTGAGCCTGCTTGGG + Intronic
925891375 2:8437844-8437866 AAAAGCTGAAGAGCTGGCTTAGG + Intergenic
926055768 2:9773084-9773106 GAATGCTGCAGAGCACGGTGGGG - Intergenic
927091281 2:19714722-19714744 ATTTACTGCAGAGCCCCCTTAGG + Intergenic
927685962 2:25170593-25170615 TAATGCAGCAGAACCTGCTTTGG + Intergenic
935942940 2:108260330-108260352 AAATGCTGCAGGCCCCACTGAGG - Intronic
945373185 2:209047013-209047035 AAATTTTGCAGATCCCCCTTAGG + Intergenic
946592075 2:221261561-221261583 AAATGCTGCAGACTCAGTTTAGG - Intergenic
947704125 2:232260774-232260796 AAAGGCTGGAGAGACCACTTTGG - Intronic
948265262 2:236631531-236631553 ATCTGCTGCAGAGCCTGCTCTGG - Intergenic
948921379 2:241067529-241067551 GACGGCTGCAGAGCCCGCTGTGG - Intronic
1168998978 20:2153202-2153224 AAATGCTGCAGAGCCCGCTTTGG + Intronic
1173117028 20:40254240-40254262 AAATGCTGCAGAGCCCTGCAGGG + Intergenic
1173783731 20:45777104-45777126 AAATGCTGCAGCACCGGCTGTGG - Exonic
1175383320 20:58578374-58578396 AACTGCTGCTGAGCCCCCTCAGG + Intergenic
1178728627 21:35078664-35078686 AAACGCTGCTGAGCCCTCCTGGG + Intronic
1179621560 21:42619813-42619835 AAAAGCTGGAGAGCCAGCTGAGG - Intergenic
1181184909 22:21096304-21096326 AAAGGCTGCAGAGCCACTTTTGG + Intergenic
1181366166 22:22378632-22378654 AAATCCTGCAGAGCCATCCTTGG + Intergenic
1183028636 22:35085396-35085418 AGAAGCTGCAGAGACAGCTTAGG + Intronic
1183121465 22:35733133-35733155 CCATGCTGCAGAGGCTGCTTGGG - Intergenic
1184959514 22:47918807-47918829 AACAGCTGCAGAGCCGGCTCCGG - Intergenic
949511154 3:4768465-4768487 AAAGGCTGCAGAGTCCTCATGGG - Intronic
956615615 3:71168963-71168985 CAGTGCTGCTGAGCCCGCATGGG + Intronic
961003532 3:123389877-123389899 AAATGGTGCAGTGCTCGCTGGGG + Intronic
962532841 3:136299128-136299150 AATGTCTGCATAGCCCGCTTTGG + Intronic
962746978 3:138404170-138404192 AACTGCTGCAGATACCACTTAGG - Exonic
967425015 3:189316880-189316902 AAATGCTCAAGAGCCAGCTCGGG + Intronic
968128812 3:196180057-196180079 CAAGGCTGCAGAGCCCACTCAGG + Intergenic
968541084 4:1168776-1168798 CAATGCTGCAGAGCCCTGTCAGG + Intronic
970261404 4:14228663-14228685 TAATGCTGAAGAGCCAGGTTGGG + Intergenic
974297207 4:60016234-60016256 AAATACTGTAAAGTCCGCTTAGG - Intergenic
984778965 4:183506210-183506232 ACATGCTGCAAACCCCGATTCGG - Intronic
985073285 4:186189906-186189928 AAATGCTGCAGAGCCAGGAGGGG - Intergenic
985971595 5:3382503-3382525 AAATGCAGCAGAGCTGGTTTGGG - Intergenic
992363932 5:76072164-76072186 AAATTCTGCAGTGCCTTCTTTGG - Intergenic
1001012477 5:168111036-168111058 AAATGATGCAGAGCATGCTGGGG - Intronic
1005249760 6:23930959-23930981 GATTGGTGCAGAGCCCTCTTTGG - Intergenic
1006657770 6:35610995-35611017 GATTGCTGCATAGCCTGCTTGGG + Intronic
1008731962 6:54493462-54493484 AAAAGCAGCAGAGCCAGCTCAGG - Intergenic
1009990481 6:70836991-70837013 AAAAGCTGCGGAGCCCACTGTGG + Exonic
1010066857 6:71692363-71692385 AGATGCTGGAGAGCCTCCTTAGG - Intergenic
1019640395 7:2100537-2100559 AGATGGTGCAGGGCCCGCTCAGG - Intronic
1022536194 7:31100155-31100177 GAGTGCTGCTGAGCCCGCTGTGG - Exonic
1025878599 7:65510057-65510079 AAAAGCTTCAAAGGCCGCTTCGG + Intergenic
1029733700 7:102454045-102454067 AGATGCTGCAGAGCCCTGGTGGG + Exonic
1031962044 7:127998859-127998881 ACATGCTGCTGAGCTCACTTGGG - Intronic
1034008769 7:147505102-147505124 AAATGCTGCAAAGCTCACTCCGG + Intronic
1036911022 8:12756351-12756373 CAAAACTGCAGAGCCAGCTTGGG - Intergenic
1042943314 8:74129569-74129591 AGATCCTGCAGAGCCAGCTGAGG + Intergenic
1043723490 8:83578433-83578455 GGATGCTGCAGGGCCTGCTTTGG + Intergenic
1043863538 8:85350323-85350345 AAATTCTGGAGAGGCTGCTTAGG + Intronic
1049044901 8:140141956-140141978 AAATGCTGCTGAGCACCCTGGGG + Intronic
1050301348 9:4261927-4261949 ATCTGCTGGAGAGCCCTCTTTGG - Intronic
1056932321 9:90889503-90889525 AAATGCTGCAGATGCCACCTGGG + Intronic
1056938524 9:90936380-90936402 CAATGATGCAGAGCAGGCTTTGG + Intergenic
1057395826 9:94679097-94679119 AAATGCTGCAGACCCCTCACAGG - Intergenic
1062672058 9:137716741-137716763 AAATGCTGCAAAGCACACTCAGG + Exonic