ID: 1169003336

View in Genome Browser
Species Human (GRCh38)
Location 20:2184556-2184578
Sequence CTGTGAGAGCCAAAGGAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169003336_1169003341 28 Left 1169003336 20:2184556-2184578 CCCATTTCCTTTGGCTCTCACAG No data
Right 1169003341 20:2184607-2184629 CATTTGCACCATCATAAAATAGG No data
1169003336_1169003339 0 Left 1169003336 20:2184556-2184578 CCCATTTCCTTTGGCTCTCACAG No data
Right 1169003339 20:2184579-2184601 CATTGTATTGCTTCTTCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169003336 Original CRISPR CTGTGAGAGCCAAAGGAAAT GGG (reversed) Intergenic
No off target data available for this crispr