ID: 1169003665

View in Genome Browser
Species Human (GRCh38)
Location 20:2189032-2189054
Sequence TATTGTGAACAGAGTGTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169003665_1169003674 24 Left 1169003665 20:2189032-2189054 CCCTCTACACTCTGTTCACAATA No data
Right 1169003674 20:2189079-2189101 ATTGAAGCTCTCTGTTCTGAAGG No data
1169003665_1169003667 -6 Left 1169003665 20:2189032-2189054 CCCTCTACACTCTGTTCACAATA No data
Right 1169003667 20:2189049-2189071 ACAATAAAGCCTGTTCCCCTAGG No data
1169003665_1169003668 -5 Left 1169003665 20:2189032-2189054 CCCTCTACACTCTGTTCACAATA No data
Right 1169003668 20:2189050-2189072 CAATAAAGCCTGTTCCCCTAGGG No data
1169003665_1169003669 -4 Left 1169003665 20:2189032-2189054 CCCTCTACACTCTGTTCACAATA No data
Right 1169003669 20:2189051-2189073 AATAAAGCCTGTTCCCCTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169003665 Original CRISPR TATTGTGAACAGAGTGTAGA GGG (reversed) Intergenic
No off target data available for this crispr