ID: 1169005229

View in Genome Browser
Species Human (GRCh38)
Location 20:2201102-2201124
Sequence CTGTGAAATGCTCAGGTAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169005224_1169005229 6 Left 1169005224 20:2201073-2201095 CCACTTAGTTTGCCAACTTTGAA No data
Right 1169005229 20:2201102-2201124 CTGTGAAATGCTCAGGTAACTGG No data
1169005226_1169005229 -6 Left 1169005226 20:2201085-2201107 CCAACTTTGAAGGAATCCTGTGA No data
Right 1169005229 20:2201102-2201124 CTGTGAAATGCTCAGGTAACTGG No data
1169005223_1169005229 28 Left 1169005223 20:2201051-2201073 CCTACAATTGGTGGGAGTGAAAC No data
Right 1169005229 20:2201102-2201124 CTGTGAAATGCTCAGGTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169005229 Original CRISPR CTGTGAAATGCTCAGGTAAC TGG Intergenic
No off target data available for this crispr