ID: 1169005526

View in Genome Browser
Species Human (GRCh38)
Location 20:2204144-2204166
Sequence CAGTGTGGCTGGAATGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169005526_1169005535 25 Left 1169005526 20:2204144-2204166 CCCACTTCATTCCAGCCACACTG No data
Right 1169005535 20:2204192-2204214 TCAAGTCTTTTCCCACTTCAGGG No data
1169005526_1169005534 24 Left 1169005526 20:2204144-2204166 CCCACTTCATTCCAGCCACACTG No data
Right 1169005534 20:2204191-2204213 GTCAAGTCTTTTCCCACTTCAGG No data
1169005526_1169005531 2 Left 1169005526 20:2204144-2204166 CCCACTTCATTCCAGCCACACTG No data
Right 1169005531 20:2204169-2204191 TTGCTTTCATCCCATGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169005526 Original CRISPR CAGTGTGGCTGGAATGAAGT GGG (reversed) Intergenic
No off target data available for this crispr