ID: 1169005692

View in Genome Browser
Species Human (GRCh38)
Location 20:2205512-2205534
Sequence TACATACCATGACAGAACTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169005689_1169005692 14 Left 1169005689 20:2205475-2205497 CCTATAGTTGAACAAGTTGGGTT 0: 3
1: 11
2: 18
3: 48
4: 125
Right 1169005692 20:2205512-2205534 TACATACCATGACAGAACTATGG No data
1169005685_1169005692 27 Left 1169005685 20:2205462-2205484 CCACCAGGACACACCTATAGTTG No data
Right 1169005692 20:2205512-2205534 TACATACCATGACAGAACTATGG No data
1169005686_1169005692 24 Left 1169005686 20:2205465-2205487 CCAGGACACACCTATAGTTGAAC No data
Right 1169005692 20:2205512-2205534 TACATACCATGACAGAACTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169005692 Original CRISPR TACATACCATGACAGAACTA TGG Intergenic
No off target data available for this crispr