ID: 1169006503

View in Genome Browser
Species Human (GRCh38)
Location 20:2211701-2211723
Sequence CTACCTAAACAGGTAGAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169006496_1169006503 13 Left 1169006496 20:2211665-2211687 CCTCATCCTGCCAGGAGCTGTTT No data
Right 1169006503 20:2211701-2211723 CTACCTAAACAGGTAGAACTTGG No data
1169006499_1169006503 7 Left 1169006499 20:2211671-2211693 CCTGCCAGGAGCTGTTTCTGGGG No data
Right 1169006503 20:2211701-2211723 CTACCTAAACAGGTAGAACTTGG No data
1169006495_1169006503 14 Left 1169006495 20:2211664-2211686 CCCTCATCCTGCCAGGAGCTGTT No data
Right 1169006503 20:2211701-2211723 CTACCTAAACAGGTAGAACTTGG No data
1169006501_1169006503 3 Left 1169006501 20:2211675-2211697 CCAGGAGCTGTTTCTGGGGAGAA No data
Right 1169006503 20:2211701-2211723 CTACCTAAACAGGTAGAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169006503 Original CRISPR CTACCTAAACAGGTAGAACT TGG Intergenic
No off target data available for this crispr