ID: 1169016529

View in Genome Browser
Species Human (GRCh38)
Location 20:2297214-2297236
Sequence GGGCACTGCTGAGACCTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 188}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169016529 Original CRISPR GGGCACTGCTGAGACCTAGC TGG (reversed) Intronic
904914665 1:33961161-33961183 GGGCAATGGTGAGACCAGGCAGG - Intronic
906239559 1:44234288-44234310 GGGCACTGCCGTTACCTAGATGG - Intronic
907020134 1:51059300-51059322 AGGCACTGTTGTGACCCAGCTGG + Intergenic
910872345 1:91846406-91846428 GGGCCAGGCTGAGACCTGGCAGG + Intronic
913203762 1:116517142-116517164 GGTCTCTGCTGAGATCTAGGTGG - Intronic
915090326 1:153419623-153419645 GAGCATTGCTGTGACCTGGCAGG - Exonic
915674047 1:157514556-157514578 GGCCTCTGCTGAGACCTATAGGG + Exonic
918046756 1:180946186-180946208 AGGGACTGCTGAGAACCAGCAGG - Exonic
918275903 1:182953364-182953386 GGGCGCTGCTCAGAGCTAGGTGG + Exonic
1070801595 10:79247283-79247305 GGGCACTGATGAGGCCTTTCCGG + Intronic
1072898335 10:99386698-99386720 AGCCACTGTTGAGACCTTGCCGG + Intronic
1074572418 10:114636119-114636141 GGGCAGTGCTGAGTCCAACCTGG + Intronic
1075263578 10:120982430-120982452 GGGCACTGGTGAGAACTAAATGG + Intergenic
1076737716 10:132466168-132466190 GGGCACCACTGGGACCCAGCTGG + Intergenic
1080040004 11:27749578-27749600 GGTGACTGCTGAGATCTTGCAGG - Intergenic
1080518284 11:33043143-33043165 GAGAATTGCTGAAACCTAGCAGG + Intronic
1082909866 11:58359015-58359037 GGGCATTGGTTAGACCAAGCAGG + Exonic
1084494096 11:69494187-69494209 GGCCTCTGCTTAGACCTGGCGGG - Intergenic
1085348860 11:75785435-75785457 GGGCTGTGCTGAGAGATAGCAGG - Intronic
1085403874 11:76250270-76250292 AGGCACTGTTGTGACCCAGCTGG + Intergenic
1087171946 11:95058144-95058166 AGGCACTGCTGAGTCCAAGGTGG + Intergenic
1088214140 11:107489602-107489624 GGGTACTGATGATACCTAGTAGG - Intergenic
1088750206 11:112836571-112836593 GGGCACTGCTGAGAGACAGAGGG - Intergenic
1089158181 11:116417746-116417768 GGGCACTGCTTAGGGCTGGCAGG - Intergenic
1090436338 11:126689738-126689760 GGCCTCTGCTGAGACCCAGGTGG - Intronic
1094018021 12:25884744-25884766 GGGCACTGCAAAAACCTGGCCGG + Intergenic
1095944896 12:47748253-47748275 GGACACTGCTGGGACCTTGCAGG - Intronic
1097446555 12:59678966-59678988 GGGCACTGTTGCAACCCAGCTGG - Intronic
1098832089 12:75375389-75375411 GGGGACTGATGAGACCTTGCAGG - Intronic
1099904659 12:88758046-88758068 GGGCATTGCTGAGAGTTAGAGGG - Intergenic
1106999633 13:35527605-35527627 GGGCACTGCTGTGACCCAGCCGG - Intronic
1107967192 13:45607891-45607913 GGGCACTGCAGAGAACTCACAGG + Intronic
1108746443 13:53399773-53399795 GGGTACTGCTGGCACCTAGTGGG + Intergenic
1111488842 13:88943084-88943106 GGCCAATGATGAGACCTAGTAGG + Intergenic
1111595312 13:90403753-90403775 GGACGCTGTTGAGACCTGGCTGG + Intergenic
1113727799 13:112618120-112618142 GGCCTCTGCTGTGACCTGGCCGG - Intergenic
1113791141 13:113029049-113029071 TGACACTGATGAGACCTACCTGG - Intronic
1116541627 14:46108237-46108259 GGGCACTGTTGCAACCTGGCTGG - Intergenic
1118537482 14:66783740-66783762 TGGCTCTGCTGAGACCTTTCTGG - Intronic
1118814528 14:69300664-69300686 GGGGACTGCTAGGACCTAGGAGG - Intronic
1121359732 14:93245726-93245748 GGGCACTGCTGAGTCCCAGTGGG + Intronic
1122351612 14:101097702-101097724 GGTCACTTATGAGACCTAACTGG - Intergenic
1123031009 14:105451049-105451071 GGGCTCTGCTGCCACCTGGCTGG + Intronic
1128111410 15:65078384-65078406 GGGCTCTGCTGAGAGCTGGTGGG + Intergenic
1128739392 15:70073199-70073221 GGGCACTCCTGACTCCTACCAGG - Intronic
1128946748 15:71828624-71828646 GGGCATTACTGAGAGGTAGCTGG - Intronic
1130273414 15:82464166-82464188 GGGCTTTGCTGAGGCCCAGCTGG + Intergenic
1130465765 15:84191537-84191559 GGGCTTTGCTGAGGCCCAGCTGG + Intergenic
1130498500 15:84481999-84482021 GGGCTTTGCTGAGGCCCAGCTGG - Intergenic
1130588054 15:85196133-85196155 GGGCTTTGCTGAGGCCCAGCTGG + Intergenic
1131401364 15:92128139-92128161 GGCCACTGCTGAGAGCTACGTGG - Intronic
1131436265 15:92425139-92425161 GGGAACTGCTGATACCTGCCTGG - Intronic
1132328074 15:100988626-100988648 GGGGACTGCAGGGACCTGGCAGG - Exonic
1132466309 16:78820-78842 AGGGTCTGCTGAGACCGAGCAGG - Intronic
1132897002 16:2233889-2233911 GGGCACCGCTGAGGCCTCGCTGG - Exonic
1133314547 16:4874592-4874614 GGTGACTGCAGAGAGCTAGCTGG - Exonic
1133924610 16:10182666-10182688 GGCCACTGCTGAGAACTATGTGG - Exonic
1135632063 16:24043795-24043817 GGGCACTGCTGGGACCTGCAGGG + Intronic
1136078701 16:27837468-27837490 GGCCTCTGCTGATACCTGGCTGG + Intronic
1139385588 16:66566953-66566975 GAGAGCTGGTGAGACCTAGCTGG + Intronic
1140291603 16:73664159-73664181 AGGCACTGCTGTCACCTAGGAGG + Intergenic
1141956392 16:87374703-87374725 GGGCACTGCAGGGACCATGCTGG + Intronic
1143101059 17:4505031-4505053 GGACACCGCTGAGACCCACCAGG - Intronic
1146425241 17:32732014-32732036 GGGCACTGTTGCAACCCAGCTGG + Intronic
1147038508 17:37699574-37699596 GTGGACTGCTGAGGCCCAGCAGG - Intronic
1152424605 17:80212134-80212156 GGGCACTGCTGAACCCTTACTGG - Exonic
1154975508 18:21453743-21453765 TGCCAGTGCTGTGACCTAGCAGG - Intronic
1159552209 18:69906953-69906975 GGGCAGTGCTCCAACCTAGCGGG - Intronic
1159704941 18:71674969-71674991 GGGCACTTTTGTGACCCAGCTGG - Intergenic
1160098526 18:75898808-75898830 GGGCACTGCTGGGACCAGCCAGG - Intergenic
1160322157 18:77905891-77905913 GGGCACTCCTGAGACCGGGCAGG + Intergenic
1160863131 19:1245946-1245968 GGGCACAGCTGGGACTTAGCAGG + Intergenic
1163615737 19:18327056-18327078 GGGCAGTGCTGAGACTCAGGAGG - Intergenic
1163730822 19:18948310-18948332 TGGGACTGCTGAGACCTAGGGGG + Intergenic
1164402105 19:27909732-27909754 GGGCAGAGCTGAGGCCTAGATGG - Intergenic
1164421478 19:28097195-28097217 GAGGACTTCTTAGACCTAGCAGG + Intergenic
1166140816 19:40804197-40804219 GGGCACTGGGGAGACCAACCTGG + Intronic
1166947506 19:46405960-46405982 GGCCGCTGCTGATACCTAGCAGG + Intergenic
1166963756 19:46515363-46515385 GGGCACTGGGGAGCCATAGCAGG - Intronic
925411757 2:3643600-3643622 GGGCACGGCAGAGCCCTTGCCGG - Intronic
926304318 2:11627101-11627123 GGGAACTGCTGGGGCCTACCTGG - Exonic
926801965 2:16666562-16666584 TGGCACTGCTGAGTCCTCTCCGG - Intergenic
927450721 2:23207145-23207167 TGGCACTGCTGAGAAGTGGCTGG - Intergenic
927613629 2:24566783-24566805 GGGCACTGTTGCAACCCAGCTGG - Intronic
927861768 2:26564399-26564421 GGGAACTGCTGAGAAGTGGCAGG - Intronic
927960771 2:27239486-27239508 GGGCACTACTGAGATCAGGCAGG - Intronic
928175810 2:29033668-29033690 GGGTATCGCTGAGACCTAGTTGG + Intronic
930027009 2:47035047-47035069 GGGCACTCCTGGGATCTACCTGG + Intronic
931757162 2:65384544-65384566 GGGCCCTTCTGAGAGCAAGCCGG + Intronic
937103672 2:119291013-119291035 GGGAACTGATGAGGCCGAGCCGG - Intergenic
937370435 2:121293775-121293797 GGGCACGGCTGAGGCCAAGGAGG + Intergenic
938380321 2:130832753-130832775 GGGCTCTGCTGAGACCTTCACGG + Intergenic
943059138 2:183019957-183019979 AGGCACTGCTGACAGGTAGCAGG - Intronic
946442027 2:219704703-219704725 GAGCACAGCTGAGACCAGGCTGG + Intergenic
947532008 2:230915231-230915253 GGGTGCTGCTGAGACCTCCCCGG - Intronic
1169016529 20:2297214-2297236 GGGCACTGCTGAGACCTAGCTGG - Intronic
1169189088 20:3645815-3645837 GAGCTCTGCTGAGACCTGCCAGG - Intronic
1170221481 20:13946833-13946855 GGGCACTGTTGCAACCCAGCTGG + Intronic
1170706608 20:18749524-18749546 GGTCACAGCTGAGACCTGGAGGG - Intronic
1171050317 20:21851877-21851899 TGGCACTGCTAAGGCCTGGCTGG + Intergenic
1172124358 20:32616507-32616529 GGGCTCTGCTGACCCCTTGCTGG - Intergenic
1173330955 20:42075916-42075938 GGTCACTTCTGTGACATAGCTGG - Exonic
1177126300 21:17197461-17197483 GGGTCCTGCTGAGACCGAACTGG - Intergenic
1177344963 21:19855797-19855819 AGGCACTGTTGTGACCTGGCTGG - Intergenic
1179008108 21:37531900-37531922 GGGCACTGCCAAGACAGAGCTGG + Intergenic
1179905223 21:44419090-44419112 AGGCCCTGCTGACACCTAGCAGG - Intronic
1181528093 22:23501606-23501628 GGGCACTGCAGAGATGTAACTGG - Intergenic
1182475965 22:30576506-30576528 GGGCACTGCTCAGAGCTCTCTGG - Intergenic
1183214073 22:36467903-36467925 GGGCACCGCTGACACCTGGGTGG + Exonic
1184067653 22:42129520-42129542 GGCCACTGCCGAGACCTGGCAGG - Intronic
1184806318 22:46796879-46796901 GGGCACTGGTGAGACCCAGGAGG + Intronic
1185027617 22:48424728-48424750 GAGCATTGCTGAGACCTCTCAGG + Intergenic
1185107522 22:48882788-48882810 GGGCAGAGCTGAGGCCTACCAGG - Intergenic
1185276873 22:49953679-49953701 GGGACCTGCTGAGGCCTGGCAGG - Intergenic
949226264 3:1699611-1699633 AGGCACTGCTGCAACCTAGCTGG + Intergenic
950677390 3:14562759-14562781 GGGCGATGCTGAGACCTGTCCGG - Intergenic
950789586 3:15461676-15461698 AGTCACTGCTGTGACCTTGCAGG + Intronic
950868967 3:16212685-16212707 TCGCATTGCTGAGACCTGGCTGG + Exonic
951145889 3:19226781-19226803 GGGCACTGCAGAGCCCCAGAAGG - Intronic
951340801 3:21484484-21484506 GGGCACTGGAGAGACATCGCAGG - Intronic
951509719 3:23487181-23487203 GGGCACTGCTGCGACCGAGCTGG - Intronic
952889645 3:38031396-38031418 GGGCACTGCTGACTCAGAGCTGG + Intergenic
953142712 3:40244526-40244548 TGGCACTGATGAGACCCATCTGG + Exonic
953787468 3:45921923-45921945 GGTCACTGCAGTGACCTGGCTGG + Intronic
954448590 3:50559696-50559718 GCCCACTGCAGAGACCCAGCCGG - Exonic
954762611 3:52887591-52887613 GTGAACTGCTGAGCCCTACCAGG - Intronic
957646603 3:82939105-82939127 GGGCACTGTTGCAACCCAGCAGG + Intergenic
959389795 3:105759632-105759654 GGGCACTGTTGTGACCTGGCTGG - Intronic
961617200 3:128192304-128192326 GGGCACACCTGAGAACCAGCAGG - Intronic
963972928 3:151449214-151449236 GGACACTGCTGAGCACTAGAGGG + Exonic
965774066 3:172209949-172209971 GGGCACTGTTGCGAGCCAGCCGG - Intronic
966920811 3:184610360-184610382 GGGCCCTGCTGAGAACAAGGAGG + Intronic
968474157 4:795319-795341 GAGCACTGCTGCGACCCCGCCGG + Intronic
968660618 4:1797360-1797382 GGCCTCTGCTGGCACCTAGCAGG + Intronic
968668651 4:1835654-1835676 GGGCTCTGCTGAGAACAGGCAGG + Intronic
968742272 4:2337294-2337316 GGGCACTCCCGAGACACAGCAGG + Intronic
974525783 4:63048110-63048132 GGGCACACCTGAGCCATAGCTGG + Intergenic
974697566 4:65396183-65396205 GGGCACTGTTAAAACCTTGCTGG + Intronic
975498249 4:75057688-75057710 AGGCACTGCTGCAACCTGGCTGG + Intergenic
977347497 4:95835862-95835884 GGGCACTGCTGCCCCCTAGAAGG - Intergenic
978851820 4:113347033-113347055 GGTGACTGCTGAGACCTGGAGGG + Intronic
982181041 4:152748675-152748697 AGGCACTGTTGTGACCCAGCTGG + Intronic
983197359 4:164822366-164822388 CAGCACTGGTGAGATCTAGCAGG + Intergenic
985492805 5:189183-189205 AGGCACTGCTGAGTCCCTGCTGG - Exonic
988020030 5:25609857-25609879 GGGCAGTGCTGAGCCCTCACAGG + Intergenic
988782181 5:34532402-34532424 AGGCACTGCTGAGAGCAGGCTGG + Intergenic
988940329 5:36139211-36139233 AGGCACTGTTGTAACCTAGCTGG + Intronic
990040558 5:51374088-51374110 GGGCACTGCTGCCTCCTATCAGG + Intergenic
993211912 5:84962283-84962305 AGGAACTGTTGTGACCTAGCTGG - Intergenic
994840621 5:104920724-104920746 GGGCTCTGTTGACACCTAGTGGG - Intergenic
995440992 5:112192031-112192053 GGACACTGCTGAGAACTGGCTGG + Intronic
998083806 5:139299554-139299576 GGTCCCTGCTGAGACCAAGGAGG + Intronic
1000143972 5:158434934-158434956 GGGCAAAGCTGAGCCCTAGCCGG - Intergenic
1000190815 5:158908951-158908973 GGGCACTGTTGAGAGCCAGTCGG - Intronic
1001026801 5:168231541-168231563 GGGCAATGGTGAGCCCTACCTGG + Intronic
1001589648 5:172856581-172856603 AGGCACTGGGGAGCCCTAGCAGG + Intronic
1002549338 5:179975361-179975383 GGGCGCTACTGACACCTAGTGGG + Intronic
1002644517 5:180646591-180646613 GGGCCCTGGTGAGGCCCAGCTGG - Intronic
1003103441 6:3195111-3195133 GGGCTCTGCAGAGTCCTTGCCGG + Intergenic
1004455842 6:15790779-15790801 GGGCACTGCAGACCCCCAGCAGG - Intergenic
1004511301 6:16286251-16286273 AGGCACTGCTGCCCCCTAGCGGG - Intronic
1004720896 6:18266394-18266416 GGGCGCTGCTGCAACCCAGCTGG - Intergenic
1006847376 6:37071958-37071980 GGGCACTGCCCAGACCCTGCTGG - Intergenic
1007425154 6:41741795-41741817 GTCCACTGCTGACCCCTAGCAGG - Intronic
1011822935 6:91273934-91273956 GGGCCCAGCTGTGAGCTAGCAGG + Intergenic
1012815584 6:104018516-104018538 TGGTACTGCTGAGACCCAGGAGG + Intergenic
1017809539 6:157974913-157974935 GGGGACAGCTGAGGCCTTGCAGG - Intergenic
1017819702 6:158040444-158040466 TGGCTCTGCTGAGTCATAGCTGG + Intronic
1019584940 7:1795350-1795372 GGGCACTGGAGAGACATGGCAGG + Intergenic
1019709310 7:2511113-2511135 GAGCCCTGCTGAGCCCCAGCTGG + Intergenic
1020376588 7:7494176-7494198 GGGCAGTGCTGATAAATAGCAGG - Intronic
1021021195 7:15600216-15600238 GGGCACTGCTGCAACCCAGCCGG - Intergenic
1022136916 7:27457647-27457669 GGGAACTGCAGAGACCTTGTTGG - Intergenic
1022647912 7:32248605-32248627 GAGCTCTGCAGAGACCTAGAAGG + Intronic
1024084028 7:45878724-45878746 GGGCATTTCAGAGACCTAGGGGG - Intergenic
1024956475 7:54926505-54926527 TGGCACAGCAGAGACCTGGCAGG + Intergenic
1026511516 7:71031292-71031314 GGTCACTGATGAGGCCTAACTGG + Intergenic
1026807254 7:73436116-73436138 TGGCACTGCTGAGTCCTCTCTGG + Exonic
1028884396 7:95914788-95914810 GGGCACAGCTGGCACCCAGCCGG - Intronic
1028934353 7:96448741-96448763 GGGCACTGCAGTTACTTAGCTGG + Intergenic
1032165519 7:129541778-129541800 GGGTACTGCAGAGGCCTGGCAGG - Intergenic
1034948111 7:155277178-155277200 GGGAACTGCAGAAAGCTAGCAGG + Intergenic
1035265079 7:157685796-157685818 GGGGACTCCTGGGACCCAGCGGG - Intronic
1035552171 8:537152-537174 GGGCACTGCTGAGCCCCACGTGG + Intronic
1035661721 8:1353021-1353043 GGACATTGCTGAATCCTAGCAGG - Intergenic
1036769922 8:11571894-11571916 CGGCTCTGCTGAGGCCTGGCAGG - Intergenic
1039429477 8:37514647-37514669 GGGCGCTGGTGAGAGCTACCAGG - Intergenic
1039447687 8:37645868-37645890 GTGCAGTGCGCAGACCTAGCAGG - Intergenic
1041321087 8:56613312-56613334 GGGCACTTCTGAGACTTAAAGGG - Intergenic
1044613830 8:94119765-94119787 GGGCACTGTTGCAACCCAGCCGG + Intergenic
1057039208 9:91835206-91835228 TGGCACTGCTGTGAACTGGCTGG - Intronic
1059495843 9:114708789-114708811 GGGCACTGCTGATCCCATGCAGG + Intergenic
1059681468 9:116590354-116590376 AGGCACTGTTGTGACCTGGCTGG + Intronic
1061251350 9:129428304-129428326 GGGCTCAGCAGAGACCCAGCTGG + Intergenic
1061371844 9:130201785-130201807 TGGCTCTGCTGAGCCCTTGCTGG + Intronic
1061659304 9:132118042-132118064 GGGCACTGCTGAGAAAGAACTGG + Intergenic
1061736214 9:132661481-132661503 GGGCACTGCTGGCATCTAGTGGG + Intronic
1062601335 9:137319897-137319919 GGACCCTGCTGGGCCCTAGCAGG - Intronic
1186466774 X:9789693-9789715 GGGGGCTGCTGACACCCAGCTGG - Intronic
1187371035 X:18706413-18706435 GGGCACTGCTGAGGCCCCTCTGG - Intronic
1188363240 X:29282539-29282561 GGGCACTGGTGAGACATTTCAGG - Intronic
1189414911 X:40804983-40805005 GGCCACTGCTGGGACCCTGCAGG - Intergenic
1192167390 X:68834520-68834542 GGGCACTGCTGGGACATGCCAGG + Intronic
1193396559 X:80990689-80990711 TGTCACAGCTGAGACCTGGCAGG + Intergenic
1199217918 X:145282300-145282322 TGACACTGCTGTGACCGAGCTGG + Intergenic
1199741647 X:150741289-150741311 GGGCACAGCTGAGGCTTAGACGG - Intronic
1200164835 X:154028919-154028941 GGGCTCTGCTGAGTCCGACCTGG - Intronic