ID: 1169017467

View in Genome Browser
Species Human (GRCh38)
Location 20:2303642-2303664
Sequence CCATGGCCACCGAGCCAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 188}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169017461_1169017467 3 Left 1169017461 20:2303616-2303638 CCAAAAGCTTTTGGCCTAAATTT 0: 1
1: 0
2: 0
3: 16
4: 231
Right 1169017467 20:2303642-2303664 CCATGGCCACCGAGCCAGAGTGG 0: 1
1: 0
2: 0
3: 12
4: 188
1169017458_1169017467 30 Left 1169017458 20:2303589-2303611 CCTGGAAGTTAATACCTGTAACT 0: 1
1: 0
2: 2
3: 6
4: 115
Right 1169017467 20:2303642-2303664 CCATGGCCACCGAGCCAGAGTGG 0: 1
1: 0
2: 0
3: 12
4: 188
1169017459_1169017467 16 Left 1169017459 20:2303603-2303625 CCTGTAACTTCTGCCAAAAGCTT 0: 1
1: 0
2: 0
3: 10
4: 206
Right 1169017467 20:2303642-2303664 CCATGGCCACCGAGCCAGAGTGG 0: 1
1: 0
2: 0
3: 12
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169017467 Original CRISPR CCATGGCCACCGAGCCAGAG TGG Intronic
900476460 1:2878604-2878626 CCAGGGCCACACAGCCAGAAGGG + Intergenic
902392275 1:16113506-16113528 CCAAGGCCACAGAGCCTGACTGG - Intergenic
902891532 1:19447789-19447811 GCAAGGCCACCGAGGCGGAGAGG - Intronic
903846614 1:26282863-26282885 CCTTGGCCGCTGAGCGAGAGAGG - Exonic
904304016 1:29575373-29575395 TCTTGGCCAAGGAGCCAGAGAGG - Intergenic
905917612 1:41696497-41696519 CCAAGGCCAGCGGGCCTGAGAGG + Intronic
907329122 1:53659956-53659978 CCAAGGCCACCCAGCCAGGAGGG - Intronic
907487598 1:54788250-54788272 CCAAGGCCACCCAGCCAGTCAGG - Intronic
907764585 1:57396276-57396298 CCATGCCAAACAAGCCAGAGTGG + Intronic
907921908 1:58921951-58921973 CCAAGGTCCCAGAGCCAGAGAGG + Intergenic
912347339 1:108976707-108976729 TCAATGCCACCTAGCCAGAGAGG - Intronic
912571463 1:110627188-110627210 CCAAGGTTACCGAGCCAGAAAGG - Intronic
916445399 1:164867506-164867528 AAATGGCCCCAGAGCCAGAGTGG + Intronic
919818767 1:201459571-201459593 CCAAGGTAACTGAGCCAGAGAGG - Intergenic
920100866 1:203516256-203516278 CCAAGGCTCCAGAGCCAGAGAGG - Intergenic
920689691 1:208136486-208136508 GCATGGACACCGGGCCAGAAAGG - Intronic
922980424 1:229821521-229821543 GCCTGGCCAGAGAGCCAGAGTGG + Intergenic
924445697 1:244128278-244128300 CCAGGGTCACCGAGTCAGAGAGG + Intergenic
924524557 1:244835162-244835184 CGAGGGCCGCCGAGCCAGCGCGG + Intergenic
1063396493 10:5692826-5692848 CCAAGGCCAGTGCGCCAGAGCGG - Intronic
1063600897 10:7480413-7480435 CCATGGTCACACAGCCAGTGAGG + Intergenic
1064673643 10:17740267-17740289 CCATGGGCACCGAGTCACTGAGG + Intergenic
1067007734 10:42680698-42680720 CCATGGCACCCCAGCCTGAGTGG - Intergenic
1067508660 10:46877340-46877362 CCATGGACACAGGGCCAGCGGGG - Intergenic
1067653589 10:48174510-48174532 CCATGGACACAGGGCCAGCGGGG + Intronic
1069569302 10:69484802-69484824 TCGTTGCCACTGAGCCAGAGGGG - Intronic
1069745670 10:70713434-70713456 ACATGCCCACAGAGCCAGTGGGG + Intronic
1071603439 10:86970034-86970056 CCAGGGCCCCCCAGCCCGAGGGG - Intronic
1073774968 10:106775032-106775054 CCATGGTCACTGTGGCAGAGTGG - Intronic
1077163749 11:1125867-1125889 CCATGGAAACTGAGGCAGAGAGG + Intergenic
1077677343 11:4206827-4206849 CCATGGCCCTGGAGCAAGAGAGG - Intergenic
1078822081 11:14892302-14892324 CAATGGCCACGGAGCTAGGGCGG - Intergenic
1079116207 11:17642015-17642037 CCCTGGCCTGCAAGCCAGAGAGG - Intronic
1083148772 11:60776974-60776996 CCAAGGCCACCGAGCTAGTTAGG + Intergenic
1083621262 11:64050471-64050493 CCATGGCCACACAGCCAGGAAGG - Intronic
1083910591 11:65706961-65706983 CCCTGGCAGCCGAGGCAGAGAGG - Intergenic
1084535383 11:69753317-69753339 TCCTGGCCACAGAGCCTGAGAGG + Intergenic
1084804596 11:71570108-71570130 CCAAGGCCACAACGCCAGAGGGG - Intergenic
1084805857 11:71578520-71578542 CCAAGGCCACAACGCCAGAGGGG + Intergenic
1091225128 11:133952388-133952410 CCAAGGGCACCGTGGCAGAGTGG + Intronic
1091407754 12:219937-219959 CCATGCCCACTGACCCCGAGTGG + Intergenic
1092103704 12:5905711-5905733 CCAATGGCACAGAGCCAGAGAGG + Intronic
1096503038 12:52076922-52076944 CCCTGGCCACGGAGCAGGAGCGG + Exonic
1100278530 12:93095126-93095148 CCATGACCACTCGGCCAGAGGGG + Intergenic
1101877184 12:108603586-108603608 CCATGGCCAGGGAGGCAGGGAGG - Intergenic
1102019648 12:109673285-109673307 CCATGGTCTCCCAGCCAGAGTGG + Intergenic
1102151495 12:110691511-110691533 CCAGGGCCAGCTAGACAGAGTGG + Intronic
1102253203 12:111401424-111401446 CCAGGGTCACCCAGCCAGAGTGG - Intergenic
1104673714 12:130698195-130698217 CGTGGGCCACAGAGCCAGAGGGG + Intronic
1106719765 13:32426422-32426444 CCCTCCCCAGCGAGCCAGAGAGG + Intronic
1107674474 13:42780319-42780341 CCATGGACACTGTGCCATAGAGG - Intergenic
1108624295 13:52211988-52212010 CCATGTCCAGAGAGCCAGGGTGG - Intergenic
1113894054 13:113752351-113752373 CCTCGGCCACGGAGCCAGCGCGG - Intergenic
1114393713 14:22337837-22337859 CCAAGGCCTCAGAGCCTGAGAGG - Intergenic
1115752094 14:36504109-36504131 CGATGGCCGCCGGGCCAGTGCGG + Intronic
1117176798 14:53153410-53153432 CCCTGCCCTCCCAGCCAGAGGGG - Intergenic
1121432795 14:93899429-93899451 CCAGGGTCACCCAGCCAGTGAGG - Intergenic
1121739232 14:96239921-96239943 CCATGGTCTCCAAGCCAGACTGG + Intronic
1122201174 14:100123640-100123662 CCCTGGCCACCCAGCCTGATTGG - Intronic
1122207325 14:100154489-100154511 CCATGGGCTCCCAGCCACAGAGG - Intronic
1122272606 14:100575066-100575088 CCATGGCCACTCAGCCAGGCAGG + Intronic
1123798020 15:23793488-23793510 CCCAGGCCAAGGAGCCAGAGGGG + Intergenic
1125796262 15:42406257-42406279 CCAAGGCCACACAGCCAGAGAGG + Intronic
1126783716 15:52159817-52159839 CCAGGGTCAGGGAGCCAGAGGGG + Intronic
1129601854 15:77003715-77003737 CCAAGGCCACCTAGCAAGTGTGG - Intronic
1129772078 15:78208751-78208773 CCAGGGTCACCGAGCCTGGGAGG - Intronic
1130086375 15:80780807-80780829 CCAGGGCCACAGACCCCGAGTGG - Intronic
1130093631 15:80840550-80840572 CCAGGCCCACTGAGCCGGAGAGG - Intronic
1132177830 15:99729221-99729243 CCATTGCCATCGAGCCATTGGGG + Exonic
1132573191 16:652951-652973 CCAAGGCCACTGAGGCAGAGGGG - Intronic
1132584261 16:699467-699489 CCAAGACCACAGAGCCAGGGTGG - Intronic
1133121498 16:3611426-3611448 CCGAGGCCACGGAGCCAGCGAGG + Intronic
1133156964 16:3881826-3881848 CCATAGCCACCGGGACAGTGCGG - Intergenic
1134108866 16:11502174-11502196 CCATGGCCTGCGATTCAGAGGGG + Exonic
1134597911 16:15510588-15510610 CCAAGGCCACACAGCCAGGGAGG + Intronic
1135240989 16:20806946-20806968 CCACAGCCATGGAGCCAGAGAGG + Exonic
1135767134 16:25187462-25187484 ACATGGCCTCCTAGCCAGTGAGG - Intergenic
1137605833 16:49786299-49786321 CCCTGGCCACCCTGCCAGTGGGG - Intronic
1137792238 16:51184952-51184974 CCATTGCCACCCAGAAAGAGAGG - Intergenic
1139335127 16:66226231-66226253 CCATGGACACCGAGGGAGAAGGG - Intergenic
1141482830 16:84318298-84318320 CCATTGCCACCAAGCCATCGAGG - Exonic
1142477021 17:194550-194572 CCAAGGCCACTGGCCCAGAGTGG - Intergenic
1142687762 17:1587527-1587549 CCATGGCCCCCCTGCCACAGAGG + Intronic
1143284535 17:5779455-5779477 CCATGGCCAGCCCCCCAGAGAGG + Intronic
1143563840 17:7709788-7709810 CCAGGGACACTGAGACAGAGGGG - Exonic
1144366477 17:14549586-14549608 CGATGGCCAGTGAGCCAGGGTGG + Intergenic
1145159410 17:20564517-20564539 CCATTGCCACAGGGCCACAGCGG - Intergenic
1145989578 17:29070837-29070859 CCAGGGCCCTGGAGCCAGAGCGG - Intergenic
1146008785 17:29178642-29178664 CCATGGACAAAGAGCCAGTGAGG + Intronic
1146061705 17:29611302-29611324 CCAGGGTCACCGAGCTGGAGAGG + Intronic
1147269832 17:39261261-39261283 CCATGGTCACAAAGCTAGAGTGG + Exonic
1147338864 17:39742283-39742305 CCATGGCGTCTGAGCAAGAGAGG - Exonic
1147561848 17:41514162-41514184 TCCTGGCCACCGTGGCAGAGCGG - Intronic
1147911745 17:43860135-43860157 CCATGGACACCGAGCCCAAGAGG + Intronic
1148214274 17:45825874-45825896 TCATTGCCACCAACCCAGAGAGG + Intronic
1148561604 17:48609908-48609930 CCAGGGACACAGAGCTAGAGAGG - Intronic
1151391711 17:73791601-73791623 CCATGGACAGGGAGCAAGAGGGG - Intergenic
1157706592 18:49813058-49813080 CCCTGACCACCGAGGCCGAGCGG + Intronic
1161984138 19:7644621-7644643 CCATGGGCTCCGACGCAGAGGGG + Exonic
1163132011 19:15280163-15280185 CCATGGGGACAGAGGCAGAGTGG + Intronic
1163263538 19:16205299-16205321 CGATGTCCACTAAGCCAGAGGGG - Intronic
1163439254 19:17313247-17313269 GCAAGGACACCGAGGCAGAGAGG - Intronic
1163469028 19:17486302-17486324 CCAGGGCCACCAAGCCAGCTGGG + Intronic
1164618045 19:29678325-29678347 CCCTGGCCACTGAGGCACAGAGG + Intergenic
1166324095 19:42038506-42038528 TCATGGCCACCCAGTGAGAGAGG - Intronic
1167268831 19:48497217-48497239 CCAAGGCCAAAGAGCTAGAGAGG + Intronic
1167285203 19:48595339-48595361 CCAAGGCCACACAGCCAGAGAGG - Intronic
1167659228 19:50786150-50786172 CCTGGGCCTCTGAGCCAGAGGGG + Intergenic
925129469 2:1484297-1484319 CAATGGCCACCGGGCCAGGCTGG - Intronic
926187330 2:10701204-10701226 CCATGGGCTTTGAGCCAGAGTGG + Intergenic
930741420 2:54836287-54836309 CCATGGCCTCCCACCCAGGGAGG - Intronic
931633977 2:64325775-64325797 CCATGCCCACCAAGGCAGTGTGG - Intergenic
932573464 2:72950433-72950455 CCATGGCCAGAGAGCTGGAGGGG - Intronic
935881875 2:107573445-107573467 GCCTGGCAACCGAGGCAGAGAGG - Intergenic
935918788 2:107986816-107986838 CCTTGGGCACCGAGCCCGGGCGG + Intronic
936609532 2:113988311-113988333 ACATGCCCACCAGGCCAGAGAGG + Intergenic
937832988 2:126444226-126444248 GCATGGCCACGGTGTCAGAGTGG - Intergenic
937875752 2:126824099-126824121 CCATGGGCACATAGCCAGGGAGG - Intergenic
938397813 2:130963837-130963859 CCGCGGCCACAGAGCCCGAGCGG + Intronic
945095749 2:206217401-206217423 CCATGGCAACCCAGCCATACAGG + Exonic
948850654 2:240703834-240703856 ACCTGGCCACCGCGCAAGAGGGG + Intergenic
948868062 2:240785275-240785297 CCATGGCCACCTGCCCACAGTGG + Intronic
949019774 2:241734628-241734650 CCAGAGCCGCCGAGCCGGAGTGG - Exonic
1169017467 20:2303642-2303664 CCATGGCCACCGAGCCAGAGTGG + Intronic
1169209491 20:3758213-3758235 CCAAGGTCACAGAGCCAGAATGG + Intronic
1172968686 20:38857841-38857863 CCATGTCCACCGAGAAAGACTGG - Intronic
1173079729 20:39853886-39853908 CCAGGGCAACCCAGCCAGAGAGG + Intergenic
1174177375 20:48653483-48653505 CCATGGCCTCAGAGCCTAAGGGG + Exonic
1175072374 20:56345300-56345322 CCAGGGCCACCCTGCCAGCGTGG - Intergenic
1175105395 20:56611248-56611270 CCATGCCCAGCGAGCCCCAGAGG + Intergenic
1176722011 21:10401013-10401035 ACATGGCCCCAGAGCCTGAGAGG - Intergenic
1179719823 21:43308673-43308695 CCAAGGAGACCCAGCCAGAGGGG - Intergenic
1181163169 22:20969316-20969338 CCAAGGCCACACAGCCAGAAAGG - Intronic
1182098672 22:27642639-27642661 CCATGGATACCAAGCCAGCGTGG + Intergenic
1183655999 22:39185003-39185025 CCAAGTTCACCCAGCCAGAGTGG - Intergenic
1184834284 22:47011990-47012012 ACAAGGCCACCAAGGCAGAGCGG - Intronic
1185155953 22:49193675-49193697 CCCTGCCGTCCGAGCCAGAGAGG + Intergenic
950212319 3:11133052-11133074 CCATAGCAAAGGAGCCAGAGTGG + Intergenic
950260212 3:11537939-11537961 CCAATGCCACAGAGCCAAAGTGG + Intronic
950438842 3:12995503-12995525 ACAAGGACACCGAGGCAGAGAGG + Intronic
950564833 3:13762471-13762493 CCAGAGCCACTGAGCCAGGGTGG - Intergenic
951356212 3:21670499-21670521 CTATGTCCACCGGGCAAGAGAGG + Intronic
951703567 3:25521684-25521706 CCATGGCCACCCAGCTAGTTGGG - Intronic
956776671 3:72570942-72570964 CCAAGGCCACAGAGCCAGTAAGG - Intergenic
968739354 4:2319549-2319571 CCCAGGCCACAGAGCCAGGGTGG + Intronic
969297812 4:6279975-6279997 CCAAGGCCACAGAGCCAGGATGG - Intronic
972943416 4:44224857-44224879 CCATGTCCACCCAGCCAATGGGG + Intronic
982278349 4:153659394-153659416 CCTTGTCCACGGAGCCAGCGCGG - Intergenic
985045115 4:185932732-185932754 CCAGGGCAACCGAGCCCCAGGGG - Intronic
985971389 5:3381213-3381235 CCATGGCCTCCAAGCCAGCTAGG - Intergenic
986213910 5:5699948-5699970 CCATGGCCACCCAACCAGAAGGG + Intergenic
988728158 5:33944099-33944121 CCCTTGCCACCGAGGCATAGAGG + Intergenic
990667910 5:58094518-58094540 CCATGGCCTCCAAGGGAGAGTGG - Intergenic
991231189 5:64334180-64334202 CAATGGGCACTGAGTCAGAGTGG + Intronic
991679575 5:69125484-69125506 CCATGGCAACAGAGCGAGACTGG + Intronic
994277007 5:97851162-97851184 CCATGTCCACAGGGCCAGATGGG - Intergenic
994318376 5:98360726-98360748 CCAAGGCCACGCAGCCAGAAAGG + Intergenic
998094628 5:139390317-139390339 CCAAGGCCACATAGCTAGAGGGG + Intergenic
998818028 5:146033046-146033068 CCAAGGCCACAGAGCCAGCAAGG - Intronic
999732627 5:154486199-154486221 CGTTTGCCACAGAGCCAGAGAGG + Intergenic
1002195478 5:177498661-177498683 CCATGGCCTCCAGGCCACAGGGG - Intergenic
1002213632 5:177612664-177612686 CCTTGGCCACAGAGTGAGAGAGG - Intergenic
1002837971 6:881346-881368 GCAGGGCCACCGGGCCACAGTGG - Intergenic
1005959588 6:30685998-30686020 CCATGGCCACCATCCCAGACTGG - Exonic
1006794475 6:36722781-36722803 CCAGGGCCAACGAGTGAGAGCGG + Intronic
1007835187 6:44668498-44668520 CCAAGGTCACCTACCCAGAGAGG + Intergenic
1013465622 6:110414838-110414860 CCATGGCCACCCACACACAGAGG + Intronic
1015835722 6:137418125-137418147 CAATGGCCACCTAGCCACAAAGG - Intergenic
1017770129 6:157638401-157638423 CCATGGCCACAGGCCCTGAGAGG - Intronic
1019024171 6:168943286-168943308 ACAGGGACACCGAGCCACAGAGG + Intergenic
1019289756 7:244664-244686 CAATGGCCACAGACCCAGTGGGG + Intronic
1019516996 7:1444539-1444561 CCAAGGCCACACAGCCAGGGAGG + Intronic
1021920572 7:25481009-25481031 TCCTGGCCACAGAGCCAGTGAGG - Intergenic
1022090967 7:27108058-27108080 CCATGGCGCCCGAGGCAGCGTGG + Exonic
1025615793 7:63114778-63114800 CCATGGCCGCCGTGGCCGAGCGG - Intergenic
1025978833 7:66391406-66391428 GCAGGGCCACAGAGCCGGAGAGG - Intronic
1026824109 7:73570623-73570645 TCCTGGCCACCGAGCCATGGTGG - Exonic
1029425143 7:100490004-100490026 CCATGGCAACCCATCCAGACAGG + Intronic
1030206260 7:106955115-106955137 CCATGGCCACAAAGCCAAACAGG + Intergenic
1032267744 7:130380672-130380694 ACATGGCAACACAGCCAGAGAGG + Intronic
1032396663 7:131595018-131595040 CCTTGGCCAAAGAGCCACAGAGG + Intergenic
1037962058 8:23105187-23105209 CCAGAGTCACAGAGCCAGAGGGG - Intronic
1042497529 8:69471656-69471678 CCAAGGCCACACAGCTAGAGAGG - Intronic
1042670925 8:71262548-71262570 CCAAGGCCACAGAGCAAGGGAGG + Intronic
1047331073 8:123887360-123887382 CCATGGCAACCGAGCCAGGAGGG - Intronic
1047942284 8:129837264-129837286 CAAAGGCCACTGGGCCAGAGAGG - Intergenic
1048822905 8:138396154-138396176 CCAAGGCCACAGAGCCAGTAAGG - Intronic
1048880432 8:138868188-138868210 TCATGGCCTCCGAGGAAGAGAGG + Intronic
1053353483 9:37428506-37428528 CCATAGCCACACAGCCAGAGGGG - Exonic
1053380524 9:37645994-37646016 CCATAGCCACATAGCAAGAGAGG + Intronic
1060016068 9:120087572-120087594 CCAAGGCCACAGAGCCAGGAGGG - Intergenic
1060041849 9:120307031-120307053 CCATTCCCACCCAGCCAGATTGG + Intergenic
1062005498 9:134236642-134236664 CCCAGGCCACCGGGCCAGAGCGG - Intergenic
1062432873 9:136533722-136533744 CCATGGTCACCGAGCCTGCCCGG - Intronic
1062525525 9:136976684-136976706 CCAGGGCCAACGAGCTGGAGGGG + Intergenic
1062726262 9:138075743-138075765 CCAGGTGGACCGAGCCAGAGAGG - Intronic
1190457762 X:50642479-50642501 CCTGGGCAACAGAGCCAGAGAGG - Intronic
1190881463 X:54495408-54495430 GCATGGCCACCGAGCCCCGGGGG - Exonic
1192555162 X:72083230-72083252 CAATGGCCACAGCGACAGAGTGG + Intergenic
1198186195 X:134256214-134256236 GAGTGGCCACCGAGGCAGAGAGG - Intergenic
1200078303 X:153562858-153562880 CCAAGGCCAGGGAGCCAGCGGGG + Intronic