ID: 1169017707

View in Genome Browser
Species Human (GRCh38)
Location 20:2305195-2305217
Sequence CCACGTCCACAGAGGGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 228}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169017707_1169017720 24 Left 1169017707 20:2305195-2305217 CCCTCTCCCCTCTGTGGACGTGG 0: 1
1: 0
2: 1
3: 28
4: 228
Right 1169017720 20:2305242-2305264 CCAAGTCTCTAGTCACTGGTTGG 0: 1
1: 0
2: 0
3: 8
4: 97
1169017707_1169017717 20 Left 1169017707 20:2305195-2305217 CCCTCTCCCCTCTGTGGACGTGG 0: 1
1: 0
2: 1
3: 28
4: 228
Right 1169017717 20:2305238-2305260 AGTCCCAAGTCTCTAGTCACTGG 0: 1
1: 1
2: 0
3: 10
4: 111
1169017707_1169017716 -8 Left 1169017707 20:2305195-2305217 CCCTCTCCCCTCTGTGGACGTGG 0: 1
1: 0
2: 1
3: 28
4: 228
Right 1169017716 20:2305210-2305232 GGACGTGGGTAGTGGGCATAAGG 0: 1
1: 0
2: 1
3: 5
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169017707 Original CRISPR CCACGTCCACAGAGGGGAGA GGG (reversed) Intronic
900482838 1:2907673-2907695 CCAGATGCTCAGAGGGGAGATGG + Intergenic
900625720 1:3607725-3607747 CCACGCCCCCAGATGGGAGGCGG - Intronic
900761777 1:4477363-4477385 AGACCCCCACAGAGGGGAGAAGG - Intergenic
901131020 1:6962635-6962657 GCAGGTCCACAGAGGAAAGAGGG - Intronic
901971494 1:12912342-12912364 CCACATCCACAGGACGGAGAGGG + Intronic
903253269 1:22072590-22072612 CAACCTCCAGAGAGGGGAGGAGG - Intronic
903442019 1:23395310-23395332 CCAAGGCCACAGAGGGGACGAGG + Intronic
903649046 1:24911967-24911989 CCACTGCCAGGGAGGGGAGAGGG + Intronic
904318240 1:29679961-29679983 CCAAGTCCAGAGACAGGAGATGG - Intergenic
904608025 1:31709316-31709338 CCACGGCCCCGTAGGGGAGATGG - Intergenic
906166972 1:43693819-43693841 CCACATACTCAGAGGAGAGACGG + Intronic
906242280 1:44249366-44249388 CCACTAACACACAGGGGAGAGGG + Intronic
906255335 1:44344870-44344892 CCAGGTCCCCAGTGGGGACAGGG + Intronic
906846752 1:49200869-49200891 CAACCTCCAGGGAGGGGAGAGGG - Intronic
907190064 1:52640915-52640937 CAACCTCCAGGGAGGGGAGAGGG + Intronic
907801168 1:57767146-57767168 CTACCTCCACAGAGGTGGGAGGG + Intronic
909264530 1:73539530-73539552 CCAACTCCAGAGAGGGGAGAGGG + Intergenic
909447053 1:75759294-75759316 CAACCTCCAGGGAGGGGAGAGGG - Intronic
910502031 1:87903335-87903357 CCAGGTGAACAGAAGGGAGAGGG + Intergenic
915095615 1:153460244-153460266 CCAGCTCCACAGAGGGTGGAGGG - Intronic
916506076 1:165429142-165429164 CGAGGGACACAGAGGGGAGAGGG + Intronic
918125384 1:181579257-181579279 CCCAGTTAACAGAGGGGAGAAGG - Intronic
920987282 1:210902436-210902458 CCATGTGCACAGAGGTGTGAGGG - Intronic
923245954 1:232132303-232132325 CAACCTCCAGAGAGGGGAGAGGG + Intergenic
924168905 1:241316335-241316357 CCACCTCCAGGGAGAGGAGAAGG - Intronic
924209893 1:241753876-241753898 CCACATCCACAGATGGGATATGG + Intronic
924284765 1:242475201-242475223 ACACACCCACAGAGGGGAAAAGG + Intronic
1062837982 10:648730-648752 CCACGTCCACAGTGGACAGTGGG + Intronic
1063612052 10:7570942-7570964 CCATGTGCACAGAAGGCAGAGGG - Intronic
1064583321 10:16815738-16815760 CCACCTTCACAGAGGAGGGAAGG + Intronic
1065853871 10:29814149-29814171 CCAAGTACACAGAGGGAAGGAGG - Intergenic
1067088262 10:43254042-43254064 TCAGGCCCACAGAGGGCAGACGG + Intronic
1069464044 10:68622265-68622287 CCTTGTCCAAAGAGGGAAGAGGG - Intronic
1071462825 10:85914573-85914595 CCATGTCCACAGAGGGCAGCTGG - Intronic
1071610249 10:87025375-87025397 CCACCTCAACAGAGGAGACACGG - Intergenic
1072465284 10:95656911-95656933 CCACGTCCCGGGAGGGGACAGGG + Intergenic
1073565959 10:104535916-104535938 CCATGTACACAGAGGAGAGGGGG - Intergenic
1075072326 10:119327371-119327393 CCCAGGGCACAGAGGGGAGAAGG - Intronic
1075531091 10:123230404-123230426 GCATGGCCACAGAGGTGAGAGGG + Intergenic
1075940236 10:126385320-126385342 CAACCTCCAGGGAGGGGAGACGG - Intronic
1076178151 10:128384559-128384581 CCATGTCCACTCAGGGGAAAGGG + Intergenic
1076204939 10:128589637-128589659 CCACTTCCACAGAGGGATGGTGG + Intergenic
1076310257 10:129501230-129501252 CCAAGCCCAGAGAGGGAAGAGGG - Intronic
1076484101 10:130804824-130804846 CCACCTACCCAGAGGGGAGGAGG - Intergenic
1078545228 11:12242210-12242232 TCACGACCACAGAGGGGAACTGG - Exonic
1078813447 11:14795132-14795154 CAACCTCCAGAGAGAGGAGAGGG - Intronic
1083267979 11:61555661-61555683 CCACGCCCATGGAGGGGAGCGGG + Intronic
1083388270 11:62328810-62328832 TAAAGTACACAGAGGGGAGAGGG + Intergenic
1083753312 11:64775121-64775143 TCACCTTCACTGAGGGGAGAAGG + Intronic
1084781012 11:71408113-71408135 CCCCTTCCACGAAGGGGAGAGGG - Intergenic
1085193173 11:74646954-74646976 CCATGGCCAGATAGGGGAGATGG + Intronic
1091468925 12:709816-709838 CAACCTCCAGGGAGGGGAGAAGG - Intergenic
1092698963 12:11205596-11205618 CAACCTCCAGGGAGGGGAGAAGG - Intergenic
1092900601 12:13056064-13056086 CCACCTCCACACAGTGGGGACGG - Intronic
1093654063 12:21674936-21674958 CCACCTCCAGGGAGGGGACAGGG + Intronic
1096578071 12:52567038-52567060 CCAAGACCACAGAGGCGCGAGGG - Exonic
1098416109 12:70237161-70237183 TCACCTCCAGGGAGGGGAGAGGG + Intergenic
1099215407 12:79847045-79847067 ACACGTCCACAGAGGGAAAAAGG + Intronic
1101414819 12:104499816-104499838 CCATGGCCACAGGGGGCAGAAGG - Intronic
1103428718 12:120862795-120862817 CAACCTCTGCAGAGGGGAGAGGG - Intronic
1103737553 12:123070208-123070230 CCATGTCCACTGTGGGGAGCAGG + Intronic
1103850230 12:123928292-123928314 CCACACCCACAGAAGGGCGATGG - Exonic
1103875396 12:124123278-124123300 CCACCCCCACAGATGGGACAAGG + Intronic
1104425961 12:128678321-128678343 CCAAGTCCACAAAGGGGCTACGG - Intronic
1104616727 12:130276651-130276673 ACACCTCCCCAGAGGGGAGGAGG + Intergenic
1104757420 12:131277852-131277874 CCACGGCTGCAGGGGGGAGATGG + Intergenic
1107830558 13:44371298-44371320 AGACCTCCACAGAGAGGAGAGGG - Intergenic
1108252813 13:48583767-48583789 CTACCTCCAGAGAGGGGAGAGGG - Intergenic
1108578333 13:51807918-51807940 CCACCTACACAGGCGGGAGAGGG + Intergenic
1111356266 13:87107487-87107509 ATATGACCACAGAGGGGAGAAGG - Intergenic
1111706930 13:91761862-91761884 CAACCTCCAGGGAGGGGAGAGGG - Intronic
1113949020 13:114060880-114060902 CCACCTCCACAGCCGGGAGACGG + Intronic
1114513338 14:23280371-23280393 CCCCCTCCACACAGGGCAGAAGG + Intronic
1121581824 14:95037539-95037561 CCATGACCACAGTGTGGAGATGG - Intergenic
1121941534 14:98075459-98075481 CAAAGACCAGAGAGGGGAGAGGG + Intergenic
1122561341 14:102616876-102616898 CAACCTCCAAGGAGGGGAGAGGG - Intronic
1124688004 15:31798767-31798789 CCACGGCCCCAGAGGCCAGAAGG + Intronic
1124825046 15:33085334-33085356 CACTGTCCAAAGAGGGGAGAAGG + Intronic
1130284016 15:82540644-82540666 CCAAGTCAACCGAGGGGAGCGGG - Intronic
1131426060 15:92346358-92346380 CAACCTCCAGGGAGGGGAGAGGG + Intergenic
1131922048 15:97338657-97338679 CAACTTTCAAAGAGGGGAGAGGG - Intergenic
1132143435 15:99412915-99412937 CCATGACCAGGGAGGGGAGAGGG - Intergenic
1133119534 16:3597576-3597598 CCACTTCCTCAGAGAGGAGCAGG + Exonic
1137309376 16:47239046-47239068 CCACGTCCTCACATGGCAGAAGG - Intronic
1137860507 16:51841875-51841897 CCATGTCCCCAGATGGGATATGG + Intergenic
1139430644 16:66909375-66909397 ACACGATCACTGAGGGGAGAGGG + Exonic
1139787922 16:69408792-69408814 CCACTTTCACAGAGAGGAGCAGG + Intergenic
1141749858 16:85951218-85951240 TCACCTCTAGAGAGGGGAGACGG - Intergenic
1141978497 16:87534494-87534516 CAACCTCCAGGGAGGGGAGAGGG - Intergenic
1142020727 16:87780492-87780514 CCTCATCCACAGAGGACAGAGGG + Intergenic
1142236540 16:88925149-88925171 CCATGTCCGCAGTGGGCAGAGGG + Intronic
1142553317 17:753875-753897 CCAGCACCACAGAGGGGAGAGGG + Intronic
1143538118 17:7553733-7553755 CCACATCCAAAAAGGGGAGAGGG + Intronic
1143898663 17:10156799-10156821 GCACGCCCAGAGAGGGGAAAAGG - Intronic
1147254636 17:39174570-39174592 CCATGGCCACGGAGGGTAGAGGG + Exonic
1147759578 17:42788649-42788671 CAAAGTCAGCAGAGGGGAGAAGG - Intronic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1151080699 17:71325343-71325365 CAACCTCTAGAGAGGGGAGAGGG - Intergenic
1151342617 17:73481581-73481603 CTACGTCCTGCGAGGGGAGAGGG - Intronic
1151652886 17:75481051-75481073 CCATGCCCACAGACAGGAGAAGG + Intronic
1152014262 17:77739450-77739472 CAAAGTCCGGAGAGGGGAGAGGG + Intergenic
1152465950 17:80466267-80466289 CCAGGTCCACAAGGGGGACAGGG + Intergenic
1152556733 17:81056978-81057000 CCACGTCCACAGAGGAATGAAGG - Intronic
1152908253 17:82982128-82982150 CCATCACCACAGAGGTGAGAAGG - Intronic
1152908265 17:82982176-82982198 CCATCACCACAGAGGTGAGAAGG - Intronic
1155397935 18:25406114-25406136 TCACCTCCACGGAGGAGAGAGGG - Intergenic
1157775647 18:50393898-50393920 CCACCTCCAGAGAGGGGAGAGGG + Exonic
1161511968 19:4676983-4677005 CCACCTCCACAGAGATGAGTTGG - Intronic
1163612037 19:18306650-18306672 ACGTCTCCACAGAGGGGAGAGGG + Exonic
1163667763 19:18611096-18611118 CCAGGTCGCCTGAGGGGAGAAGG - Intronic
1164257822 19:23544636-23544658 CCATGTCCACAGAATAGAGAGGG - Intronic
1165742445 19:38211910-38211932 CCACTTGCACAGAGGGGAGGGGG + Exonic
1165764737 19:38343573-38343595 CCAGGTCCTCAGAGGGCTGAGGG - Exonic
1166300027 19:41908039-41908061 CCCCCTCCACAGAGGACAGAGGG - Intronic
1167493901 19:49806976-49806998 CCCCAAGCACAGAGGGGAGAGGG + Exonic
925384843 2:3454727-3454749 TCACGGCCAATGAGGGGAGAAGG - Intronic
927197563 2:20558825-20558847 CCATGACCACAGAGGGGGTAGGG + Intergenic
927287597 2:21372551-21372573 CCACCACCCCAGAGGAGAGATGG - Intergenic
927490341 2:23517112-23517134 CCACGTCCACAGCGGGCACAGGG - Intronic
928039920 2:27864823-27864845 CCCCCACCCCAGAGGGGAGAAGG - Intronic
929502854 2:42504971-42504993 CAAGGTCCACAGAGTGGTGATGG - Intronic
929836903 2:45410699-45410721 CAACCTCCAGGGAGGGGAGAAGG + Intronic
932307046 2:70711442-70711464 CCACTTCCAAAGTGGGGAGAGGG + Intronic
935212703 2:100952224-100952246 CCTCGTGCACAGAGGGCAAAGGG + Intronic
935827724 2:106968329-106968351 CCACCTCCAAGGAGGGGAGATGG + Intergenic
936452720 2:112645741-112645763 CCACGCCCCCAGCGGGGAGCCGG - Intergenic
937379581 2:121364418-121364440 CCAGCTCCACAGGTGGGAGAAGG + Intronic
940259542 2:151765795-151765817 CCACCACCACAGAGTGGGGAAGG + Intergenic
941633785 2:167913801-167913823 CCACCCCCCCAAAGGGGAGAAGG + Intergenic
947379713 2:229533331-229533353 CCATGTCAACAGAGTGGAAAAGG - Intronic
947548187 2:231027113-231027135 CCACCTCCAGAGAGTGGAGAAGG + Intergenic
948084655 2:235237375-235237397 CCAGCTCCACATAGGTGAGATGG - Intergenic
948097759 2:235350031-235350053 CCACAGCCACAGCGGGGAGATGG + Intergenic
1169017707 20:2305195-2305217 CCACGTCCACAGAGGGGAGAGGG - Intronic
1169053971 20:2604701-2604723 TCACCTCCAGGGAGGGGAGAGGG + Intronic
1169408694 20:5348607-5348629 GCACATACACAGAGGGCAGATGG + Intergenic
1169698476 20:8418896-8418918 CTGCCTACACAGAGGGGAGAGGG + Intronic
1173627636 20:44485172-44485194 TCAGGTCCACAGAGGGCAGGAGG - Intronic
1174164732 20:48576683-48576705 CCAGGTCCACAGCAGGGAGAGGG - Intergenic
1174774482 20:53331490-53331512 GCACGACCTCTGAGGGGAGAGGG + Intronic
1175169949 20:57073219-57073241 CCACGGCCACCCAGGGCAGAAGG + Intergenic
1175786061 20:61712440-61712462 CCACTGCCCTAGAGGGGAGAAGG + Intronic
1176239349 20:64068756-64068778 CAACTTCCACAGAGGGGATGAGG + Intronic
1177658708 21:24054329-24054351 GCACATGCACAGAGGGAAGAAGG - Intergenic
1179448368 21:41449884-41449906 CCAGCTCCACAGAGGAGGGAGGG - Intronic
1179486511 21:41713980-41714002 CCAGGTCCAGACAGGGGTGAGGG + Intergenic
1179519374 21:41932075-41932097 CCACCTCCAGGGAGGGCAGAGGG + Intronic
1181039057 22:20183438-20183460 CCAGGGCCACACAGGGCAGACGG - Intergenic
1181472993 22:23152283-23152305 CACAGTCCCCAGAGGGGAGACGG - Intronic
1182551002 22:31100672-31100694 GCACGTCCACAGTGGGGAGGAGG + Intronic
1183387090 22:37520996-37521018 CCAAGGCCACAGAGAGGGGAAGG - Intergenic
1183417082 22:37688744-37688766 CCACGTCCACAGAGTAGAGGGGG + Intronic
1184430928 22:44441247-44441269 CCATGTCCACAGTGGCGAGCAGG - Intergenic
1184852116 22:47126866-47126888 TCTCGTCCAGAAAGGGGAGATGG + Intronic
1185240105 22:49737775-49737797 CCACATACACAAAGAGGAGAGGG + Intergenic
1185240111 22:49737806-49737828 CCACATATACAGAGAGGAGAGGG + Intergenic
949419253 3:3848343-3848365 CCAGTTCCACAAAGGGCAGAGGG + Intronic
949592746 3:5510733-5510755 CCCCATCCAGTGAGGGGAGACGG - Intergenic
950175426 3:10870123-10870145 CCATGTTCACAGACAGGAGAAGG + Intronic
950296767 3:11838780-11838802 CCACCTTCACAGAGGGGAAAAGG - Intronic
953092948 3:39747712-39747734 CCACCTCCACAATGGGTAGAAGG + Intergenic
955037543 3:55283556-55283578 CTACCTCCTGAGAGGGGAGATGG - Intergenic
955432716 3:58865511-58865533 CCACCTTCACAGAGGGGTGCAGG + Intronic
956653729 3:71529582-71529604 TGACTTCCAGAGAGGGGAGAGGG + Intronic
956907645 3:73783110-73783132 CCTAGTCCACAGAAAGGAGATGG - Intergenic
957790090 3:84929530-84929552 GCACCTCCTCAGAGTGGAGAAGG + Intergenic
966365785 3:179185978-179186000 CCACCTCCTCAGAGGAGAGAGGG - Intronic
967103610 3:186237401-186237423 CCACGTCCACAGCAAGGAGCAGG - Intronic
968027137 3:195451853-195451875 CCAGGTCCACAAAAGGGAGAAGG - Intergenic
968461405 4:727027-727049 CCACGATCCCACAGGGGAGAGGG - Intronic
969174841 4:5390587-5390609 CCAGGTACACACAGAGGAGAAGG - Intronic
969182137 4:5450337-5450359 CCATATCCACAGAGAAGAGATGG + Intronic
969627933 4:8317141-8317163 CCTCGCCCACCAAGGGGAGAGGG + Intergenic
969671418 4:8592348-8592370 CCGCATCCACACAGGGGACAAGG + Intronic
977317863 4:95473784-95473806 AAACTTCTACAGAGGGGAGATGG + Intronic
978232133 4:106412446-106412468 CCTTCTCCAGAGAGGGGAGAGGG - Intergenic
978807472 4:112815649-112815671 ACACCTCCATAGAGGGGAGGGGG + Intergenic
978943743 4:114469838-114469860 CTACCTCCAGGGAGGGGAGAGGG + Intergenic
979927928 4:126591036-126591058 CAACCTCCAGAGAGGGGAAAAGG - Intergenic
981785564 4:148475236-148475258 CCACGAACACACAGTGGAGAAGG + Intergenic
982054152 4:151530674-151530696 CCATGTCAAAAGAGGGGAGGAGG - Intronic
985861179 5:2471709-2471731 CCACATCAGCAGAGGAGAGAAGG + Intergenic
985973330 5:3394184-3394206 CCAGGGCCACAGAGGCAAGATGG + Intergenic
987073317 5:14358167-14358189 CCACGTCCACAGCTGGGGAAGGG - Exonic
989739485 5:44753462-44753484 CAACTTTCAGAGAGGGGAGAGGG + Intergenic
996044394 5:118853724-118853746 CCACAGACACAGAGGGGAGGAGG + Intronic
997483361 5:134206889-134206911 CCACTACCGTAGAGGGGAGAAGG + Intronic
997868585 5:137486966-137486988 CCACGTCCACAGAAGTCACAGGG + Intronic
997985612 5:138499191-138499213 CCACCTCCAGAGAGCGGAAAGGG - Intergenic
999289558 5:150414838-150414860 CGACTTCCAGAGAGGAGAGAGGG + Intergenic
1002133672 5:177095883-177095905 ACCCTTCCCCAGAGGGGAGAGGG + Intronic
1002591443 5:180293470-180293492 CCAGGGCCAGAGTGGGGAGAAGG + Intergenic
1002650196 5:180685911-180685933 CCCCGTCCTCAGATTGGAGATGG - Intergenic
1002885850 6:1293127-1293149 CCACGTCAACTGAGGTGGGAAGG + Intergenic
1003059368 6:2850872-2850894 CGACCTCTGCAGAGGGGAGAGGG - Intergenic
1003431540 6:6043278-6043300 TCACGGCCCCAGAGGTGAGAGGG + Intergenic
1004959339 6:20768885-20768907 CCATGACCTGAGAGGGGAGATGG + Intronic
1005222389 6:23601548-23601570 TCACCTTCACAGTGGGGAGAGGG + Intergenic
1007009624 6:38403056-38403078 CCCTGTCCAAAGAGAGGAGAGGG + Intronic
1007267132 6:40605062-40605084 CCAAGTCCCAAGAGGGTAGAAGG - Intergenic
1007811119 6:44486313-44486335 CCAGGTCCTGAGAAGGGAGAGGG + Intergenic
1007904143 6:45442432-45442454 CCAAGTCCACAGATGGAACAAGG - Intronic
1010240902 6:73614608-73614630 CAAACTCCAGAGAGGGGAGAGGG + Intronic
1011239794 6:85258777-85258799 CAACCTCCAGGGAGGGGAGAAGG - Intergenic
1012494649 6:99821045-99821067 CCAAGCCCACTGAGGGGAGAGGG + Intergenic
1015496456 6:133888898-133888920 CCCCGGCCACAGTTGGGAGAAGG + Intergenic
1018827495 6:167420921-167420943 CCCCTTCCACAGAGGTGGGAGGG - Intergenic
1018908061 6:168086650-168086672 CCATGTCCACAGTGGGAACATGG - Intergenic
1019460466 7:1155887-1155909 ACACCTCCACAGGGAGGAGATGG + Intronic
1020822271 7:12985182-12985204 CCAGGACCACAGAAGGGTGAGGG - Intergenic
1021737403 7:23653423-23653445 CCACCTCCAGAGAGATGAGAGGG - Intergenic
1022741795 7:33129249-33129271 CCACACGCACCGAGGGGAGAGGG + Intronic
1023299872 7:38758753-38758775 CAACCTCCAAGGAGGGGAGAGGG + Intronic
1025102057 7:56143700-56143722 CGACCTCCAGACAGGGGAGAGGG + Intergenic
1026979409 7:74517853-74517875 CCAGGTGCCCAGAGTGGAGAGGG + Intronic
1029649667 7:101882758-101882780 CCACGCCCACAGAGAGGGGCTGG - Intronic
1032501332 7:132402499-132402521 CAACATACACACAGGGGAGAGGG + Intronic
1033063877 7:138134364-138134386 CCACCTCTAGGGAGGGGAGAGGG + Intergenic
1033545364 7:142394644-142394666 CCAGGTCTACACAGGGAAGAAGG - Intergenic
1034062748 7:148108080-148108102 CTCCCTCCCCAGAGGGGAGATGG - Intronic
1034232147 7:149538937-149538959 CTACCTCCAGGGAGGGGAGAGGG - Intergenic
1034281483 7:149857926-149857948 CCACGTACACAGAAAGGTGAAGG - Intronic
1034887009 7:154805798-154805820 CCAGGGCCACAGAGGTGAGGAGG + Intronic
1035070952 7:156144421-156144443 CAACGTCCCCAGAGGTGACAAGG - Intergenic
1035219425 7:157397050-157397072 ACACGTCCACATCGGTGAGAGGG - Intronic
1035935564 8:3834300-3834322 CCACATCCACAGAGGGTAAAGGG - Intronic
1036975393 8:13405298-13405320 TGAGGACCACAGAGGGGAGAAGG - Intronic
1038761024 8:30384434-30384456 CCACGTCCAGGGAGGGCGGAGGG + Intergenic
1042156382 8:65848705-65848727 GGGCGTCAACAGAGGGGAGAGGG + Intergenic
1042304496 8:67316954-67316976 CCACCTCCAAGGAGGGGAGGGGG + Intronic
1044697618 8:94938555-94938577 CAAACTCCAGAGAGGGGAGAGGG + Intronic
1045097052 8:98808912-98808934 CCACCTCCAGGGAGGGGAGAAGG + Intronic
1046547479 8:115669259-115669281 GCACGTTCACAGACGGGAGGTGG - Intronic
1047496378 8:125412030-125412052 CCTCCTCCACACAGGGGACAGGG - Intergenic
1047753370 8:127899334-127899356 TCATGTTCAGAGAGGGGAGATGG - Intergenic
1048267582 8:133001041-133001063 ACACGTGCACAGAGGGAAGATGG - Intronic
1048352365 8:133626492-133626514 CCACGTGGCCAGAGGGGAGTAGG + Intergenic
1050041291 9:1496535-1496557 CCACGTCCACTCATGGCAGAAGG - Intergenic
1050139512 9:2502783-2502805 CCACCTCCAGAGAGGGTAGACGG - Intergenic
1050857021 9:10372004-10372026 CCACATGCACAGTGGGGAGTAGG + Intronic
1052037999 9:23705260-23705282 CCCTGTCCACCTAGGGGAGAGGG - Intronic
1055394631 9:75861032-75861054 ACATGTCCACAGAGAGAAGAGGG - Intergenic
1056795986 9:89659338-89659360 ACAGGACCACAGAGGGGAGCTGG - Intergenic
1060823373 9:126673891-126673913 CCACGGCCGCAGAGAGGACAGGG - Intronic
1062207231 9:135343901-135343923 CCGGCTCCACAGAGGGGAGGGGG + Intronic
1062309559 9:135928677-135928699 CCAGGTCCCCAGAGGGGAAGGGG + Intergenic
1062536653 9:137024003-137024025 CCAGGACCACACAGGGGAGCAGG + Intronic
1203656211 Un_KI270752v1:27320-27342 CCACTTCCTCACAGGGGAAATGG - Intergenic
1186129592 X:6452210-6452232 CTACCTCCAGAGAGGGAAGATGG - Intergenic
1189509945 X:41652589-41652611 CAACCTCCAGGGAGGGGAGAGGG + Intronic
1189515559 X:41710767-41710789 CAACCTCCAAGGAGGGGAGAGGG + Intronic
1189998927 X:46665924-46665946 ACATGACCACAGAGTGGAGAAGG + Intronic
1190487985 X:50948854-50948876 CCACACCCTCAGAGGGAAGATGG + Intergenic
1192570823 X:72203045-72203067 CAACCTCTGCAGAGGGGAGAGGG + Intronic
1194694712 X:97031762-97031784 GCAGGACCACAGAGGGGAGAAGG + Intronic
1195344132 X:103931846-103931868 CGACCTCCAGGGAGGGGAGAGGG + Intronic
1195362812 X:104101363-104101385 CGACCTCCAGGGAGGGGAGAGGG - Exonic
1201612430 Y:15858196-15858218 CTACCTCCAGAGAGGGAAGATGG - Intergenic