ID: 1169020524

View in Genome Browser
Species Human (GRCh38)
Location 20:2327682-2327704
Sequence GGTCAGGCTTGGGAGCTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 245}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169020517_1169020524 9 Left 1169020517 20:2327650-2327672 CCTATGCTGAGTGCTAAGAAGAG 0: 1
1: 0
2: 0
3: 14
4: 179
Right 1169020524 20:2327682-2327704 GGTCAGGCTTGGGAGCTCAGAGG 0: 1
1: 0
2: 0
3: 26
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169020524 Original CRISPR GGTCAGGCTTGGGAGCTCAG AGG Intronic
900595968 1:3480369-3480391 GCTCAGGCATAGCAGCTCAGAGG + Intronic
900601055 1:3502781-3502803 GGGCAGGCGTGGGAGGGCAGAGG - Intronic
901436766 1:9251318-9251340 GGGGAGGCTGTGGAGCTCAGTGG - Intronic
901494541 1:9613637-9613659 GCTCAGACCTGGGAGCTCTGAGG - Exonic
902511043 1:16967345-16967367 GGACAGGCTGGGGAGGGCAGAGG - Intronic
902787873 1:18744981-18745003 GGCAAGGCTGGGAAGCTCAGGGG - Intronic
903008541 1:20314472-20314494 GGGCAGCGTTGGGAGCTCCGAGG - Exonic
906716070 1:47970235-47970257 TGTCAGGCTCTGGAGTTCAGTGG + Intronic
906932412 1:50182895-50182917 GGTCTCGCTTGGGAGTGCAGTGG + Intronic
909941417 1:81616013-81616035 GGTGAGGCTTGAGTGCGCAGTGG - Intronic
910644931 1:89504196-89504218 GGGCATGCATGGGAGCTCTGGGG - Intergenic
912479279 1:109967243-109967265 GGCCAGGCATGGTAGCTCATGGG + Intergenic
912522043 1:110252176-110252198 GGGCAGCTTGGGGAGCTCAGAGG + Intronic
914917277 1:151826382-151826404 GGTCAGGCTTGGAAGGTCCTCGG - Intronic
919921252 1:202167863-202167885 GGTCAGGCTCTGGGGCTAAGAGG + Intergenic
920311245 1:205049669-205049691 TGTCAGGCCCGGGAGCTCACTGG - Intronic
924191756 1:241560762-241560784 GGTCAGGTTTTGGACTTCAGAGG + Intronic
1064555046 10:16539515-16539537 GAGCAGGCTTGGGAGCTTCGTGG + Intergenic
1067043903 10:42974045-42974067 ATTCAGGCTTGGGAGCCCAGTGG + Intergenic
1067835112 10:49633546-49633568 AGACAGGCTTGGGGCCTCAGAGG + Intronic
1068384277 10:56304300-56304322 TGTCATGCTTGGAAGCCCAGTGG + Intergenic
1069833983 10:71297154-71297176 GCTCAGACTTGGGAGGTGAGAGG - Intronic
1070681178 10:78450210-78450232 GGTCAGCCTTGAGACCTCAAGGG - Intergenic
1070774232 10:79100493-79100515 GGCAAAGCCTGGGAGCTCAGTGG + Intronic
1072635705 10:97176503-97176525 GGACAGGCATGGGAGCTCTGAGG - Intronic
1074154509 10:110786745-110786767 GGGCAGGGTTGTGAGCACAGAGG - Intronic
1075548774 10:123376756-123376778 GGTGAGGCTGGGATGCTCAGGGG + Intergenic
1075641355 10:124066834-124066856 GGTTGGGCTTGGTTGCTCAGGGG - Intronic
1076534303 10:131167128-131167150 GGTCGGGCTGGGGAGTCCAGAGG - Intronic
1076845898 10:133069439-133069461 GGGCAGGCGTGGGAGGGCAGGGG + Intergenic
1077194104 11:1270691-1270713 GGTCTGGGTTGGGAGCCAAGAGG + Intergenic
1080749796 11:35141250-35141272 GCCTAGGCTTTGGAGCTCAGTGG - Intronic
1081618741 11:44606021-44606043 AGTCTGGTTTGGAAGCTCAGAGG + Intronic
1081864069 11:46350204-46350226 TGGCAGGCCTGGGAGCTCACTGG + Intronic
1081911543 11:46703112-46703134 GGTGAGACTTGGGCCCTCAGAGG - Exonic
1083545287 11:63545017-63545039 GATCTGGCATTGGAGCTCAGAGG - Intronic
1084453375 11:69252964-69252986 GGTCAGGCTTGGGAGTCAAGGGG - Intergenic
1084564340 11:69920795-69920817 GTTGGGGCTTCGGAGCTCAGTGG - Intergenic
1084579888 11:70016609-70016631 CGTCAGGCTTGGGAGCTCCTGGG + Intergenic
1089119723 11:116125063-116125085 GGGCAGGCCTGGCACCTCAGGGG - Intergenic
1089279331 11:117361939-117361961 CGTGAGCCTGGGGAGCTCAGTGG + Exonic
1090208508 11:124898929-124898951 GGCCAGGCTCTGGGGCTCAGCGG + Intergenic
1090954155 11:131499765-131499787 AATCTGGCTTGGGAGCTCAGGGG - Intronic
1091732641 12:2892036-2892058 GCCCAGGCTAGCGAGCTCAGTGG - Intronic
1092143334 12:6198919-6198941 GGAGAGGCTTGGGGGCTAAGAGG - Intergenic
1092239521 12:6828496-6828518 GGTCAGGCCGGGGGGCTCAGGGG - Exonic
1093811621 12:23499154-23499176 GGTCAGGCTTGGTGGCTCATGGG - Intergenic
1095542767 12:43330081-43330103 GGGCAGTCTTGGGTGCCCAGGGG - Intergenic
1096514492 12:52148511-52148533 GGCCAGGCTTGGGTTCTCGGAGG + Intergenic
1097010902 12:55952940-55952962 GAGCAGCCTTGGGAGCTGAGTGG + Intronic
1098754300 12:74339325-74339347 GTTCTTTCTTGGGAGCTCAGAGG + Intergenic
1102470404 12:113156671-113156693 GGCCAGGCTTGGAAGAACAGTGG - Intronic
1102569253 12:113817612-113817634 GGCCTGGCTTGGGATCCCAGTGG + Exonic
1103004907 12:117413476-117413498 GGTGAAGTTTGGGAGTTCAGAGG + Intronic
1103779728 12:123390150-123390172 GGTCAGGCTCCGGCGCTCATGGG + Intronic
1103944288 12:124517658-124517680 GGCGAGCCTTGGGGGCTCAGGGG - Intronic
1104384589 12:128339295-128339317 GGGCAGCCATGGGAGCCCAGGGG + Intronic
1104599298 12:130141748-130141770 GGGCAGGGCTGGGAGCTCAGTGG + Intergenic
1105638734 13:22240747-22240769 GGGCAGCTCTGGGAGCTCAGAGG - Intergenic
1106713946 13:32368619-32368641 GGTGAGGCTTGTCAGCTCATAGG + Intronic
1110983498 13:81934108-81934130 GGTAGGGGTTGGGGGCTCAGGGG + Intergenic
1115479702 14:33849400-33849422 GGGCAGGCAAGGGAGCTCAGTGG - Intergenic
1120821760 14:88918017-88918039 GTTCTGGCTTTGTAGCTCAGTGG - Intergenic
1122124548 14:99572058-99572080 GGTTAGGGTTGGGGGCTCTGGGG - Intronic
1122283667 14:100638682-100638704 GGCCAGCCTGGGGACCTCAGCGG - Intergenic
1122848729 14:104515124-104515146 GATCATGCTTCGGAGCTCGGTGG + Intronic
1123034500 14:105466433-105466455 GGTCAGGCTTGGGGGGGCGGGGG - Exonic
1123069496 14:105635513-105635535 GGCCAGACTTGGGTGCTGAGGGG + Intergenic
1123091645 14:105744764-105744786 GGGCAGGCACTGGAGCTCAGGGG - Intergenic
1123091670 14:105744843-105744865 GGGCAGGCACTGGAGCTCAGGGG - Intergenic
1123091695 14:105744922-105744944 GGGCAGGCACTGGAGCTCAGGGG - Intergenic
1123091720 14:105745001-105745023 GGTCAGGCACTGGAGCTCAGGGG - Intergenic
1123091788 14:105745238-105745260 GGGCAGGCACTGGAGCTCAGGGG - Intergenic
1123091924 14:105745752-105745774 GGTCAGCCCCTGGAGCTCAGGGG - Intergenic
1123097740 14:105774389-105774411 GGGCAGGCATTGGAGTTCAGGGG - Intergenic
1202904502 14_GL000194v1_random:60407-60429 CGTCAAGATTGGGAGGTCAGCGG + Intergenic
1125714178 15:41809923-41809945 GGTGGGGCTTGGGACCTCTGTGG + Intronic
1126140514 15:45434128-45434150 GGACAGGCAGGGGAGCCCAGCGG - Intronic
1126427774 15:48547971-48547993 AGACAGGCATGGGAGCTGAGGGG + Intronic
1127992577 15:64131724-64131746 AGCCATGCTTGGGAGCTCTGAGG + Exonic
1128533314 15:68470133-68470155 GGTCAGGCGTGAGAGCAGAGAGG + Intergenic
1129322039 15:74780852-74780874 GGTCAGGCTTGGGTGGACAGAGG - Intergenic
1129927579 15:79378650-79378672 GATGAGGCATGGGAGCTCACAGG + Intronic
1131402934 15:92141063-92141085 GGTCTGTTCTGGGAGCTCAGTGG + Intronic
1132334538 15:101037550-101037572 GCTCAGGCTGGGGACATCAGTGG + Intronic
1132668311 16:1091762-1091784 GGTCAGTTTTGGGGGCTCATGGG - Intronic
1132945924 16:2531495-2531517 GGGCAGGGCTGGGAGCCCAGCGG - Intergenic
1132974876 16:2706211-2706233 AGTCAGGCTGAGCAGCTCAGGGG + Intronic
1134683364 16:16141948-16141970 GGACAGGCGTGGGAGTGCAGAGG - Exonic
1135239039 16:20786971-20786993 AGGCAGGCTTGGGAGCAGAGAGG - Intronic
1135583867 16:23652252-23652274 GGTCAGGCTAGGGAGGTAGGTGG - Intronic
1137771068 16:51015479-51015501 GGGAAGGCCTGGGAGCCCAGGGG - Intergenic
1139406606 16:66724109-66724131 GGTCAGGGTTGGGTGGTGAGAGG - Intronic
1141860562 16:86713448-86713470 GGGCTGGCTTGGCCGCTCAGAGG - Intergenic
1142208142 16:88793669-88793691 GGTCAGGCCGGGAAGCTCAAAGG - Intergenic
1143148734 17:4793835-4793857 GCCCAGGCTTGGGAGTGCAGCGG + Intergenic
1143735877 17:8911757-8911779 GGTCAGGAATGGGAGCAGAGAGG + Intronic
1144058019 17:11558919-11558941 GGCCAGGGTTGGGCCCTCAGGGG - Exonic
1144390521 17:14789380-14789402 GCTCAGGCTAGGGAGAGCAGTGG - Intergenic
1144424443 17:15128259-15128281 GCTCATACTTGGGAGTTCAGAGG - Intergenic
1144437845 17:15257470-15257492 GGGCAGGCTTTGGTGCTCACAGG - Intronic
1144628237 17:16856461-16856483 GGTGGGGCTGGGGAGGTCAGCGG + Intergenic
1144883288 17:18441605-18441627 GGTGGGGCTTGGGCCCTCAGTGG + Intergenic
1145159829 17:20567028-20567050 GGTGGGGCTGGGGAGGTCAGCGG + Intergenic
1145861626 17:28215987-28216009 GGTCAGTGCTGAGAGCTCAGGGG + Intergenic
1147928747 17:43962875-43962897 GGTCAGTGCTGAGAGCTCAGGGG - Intronic
1147951673 17:44111134-44111156 GGACAGGAAGGGGAGCTCAGCGG + Intronic
1148158265 17:45435770-45435792 GGGAAGGCTTGGGAGGTCCGTGG - Intergenic
1148193730 17:45698442-45698464 TCTCAGCCTTGGGACCTCAGAGG + Intergenic
1149607665 17:57936237-57936259 GGCCAGGCTTGTGCACTCAGGGG - Intronic
1150433725 17:65138773-65138795 GCTCTGGCTTGGGGGCTCAGAGG + Intronic
1152131667 17:78480847-78480869 GGGCATTCTTGGGAGCACAGTGG - Intronic
1152343552 17:79738220-79738242 GGTCAGCCTCGGGATCTCAGGGG - Intronic
1152695301 17:81741124-81741146 GGGCAGGCGTGGGTGCTGAGGGG - Intergenic
1153627826 18:7038471-7038493 TCTCAGGCCTGGGAGCCCAGAGG - Intronic
1154171837 18:12057731-12057753 GGTCAGGCATGGTGGCCCAGCGG + Intergenic
1154390185 18:13930091-13930113 GCTGAGGGTGGGGAGCTCAGCGG - Intergenic
1157167375 18:45370388-45370410 GACCAGGCTGGTGAGCTCAGAGG + Intronic
1157721832 18:49931353-49931375 GGTGGGGCTTGGGAGGGCAGAGG - Intronic
1160420925 18:78743347-78743369 GGTCACAGTTGGGACCTCAGGGG - Intergenic
1160425872 18:78778805-78778827 TGTCAGCCTTGGAATCTCAGTGG - Intergenic
1161380275 19:3961167-3961189 AGACAGGCGTGGGGGCTCAGTGG + Intronic
1161524013 19:4742482-4742504 GGACAGGATTCGGAGCACAGAGG - Intergenic
1161724890 19:5923093-5923115 GGGCAGGCCTGTGTGCTCAGAGG + Intronic
1161808847 19:6459946-6459968 AGACGGGCTAGGGAGCTCAGTGG + Intronic
1162021278 19:7869648-7869670 GGCGAGGCTTCGCAGCTCAGGGG - Intronic
1163643995 19:18478100-18478122 GGCCAGGCTGGTGAGCACAGAGG - Intronic
1163692753 19:18746164-18746186 GGCCAGACTTGGGGGCTCAAGGG + Intronic
1163715230 19:18869281-18869303 GGCCCGGCTCGGGCGCTCAGCGG + Exonic
1164699220 19:30271053-30271075 GGAAAGGCTTGGGAGATAAGAGG + Intronic
1165142031 19:33705363-33705385 GGTCAGGCAGGGGACCTGAGGGG + Intronic
1165169506 19:33881518-33881540 CATCTGGCTTGAGAGCTCAGTGG - Intergenic
1166194073 19:41194643-41194665 GGTCAGGCTGAGGAGTTCAGCGG + Exonic
1166966246 19:46530870-46530892 GGCCAGGCTTGGGTGGGCAGGGG - Intronic
1168406888 19:56115102-56115124 GGGCAGGCCTGGGATCTCCGTGG - Intronic
927131230 2:20062243-20062265 GCCCAGGCTGGGGAGCTCAGAGG - Intergenic
928254823 2:29713081-29713103 GGGCAGCATTGGGAGCTAAGAGG - Intronic
929092292 2:38230988-38231010 GGACAGGCTTAGCAGCTCCGTGG + Intergenic
929410384 2:41692475-41692497 GTTCAGTCTTTGGAGCACAGAGG + Intergenic
930014237 2:46959498-46959520 GGTCAGGCTAGGAGGCTCTGTGG + Intronic
930123126 2:47776073-47776095 GGCCAGACTTTGGAGATCAGAGG + Intronic
930910909 2:56628583-56628605 GGGTAGGCTTGGGAGGGCAGTGG + Intergenic
931849205 2:66236029-66236051 GGTCATGATTGGGAGCTTTGGGG - Intergenic
932714495 2:74091521-74091543 GGTGAGGCTTGTGAGCTCTAGGG - Intronic
932798072 2:74715212-74715234 TGTCAGGCGAGGGCGCTCAGGGG + Intergenic
933054213 2:77642229-77642251 GGTCAGTCTTTGGGCCTCAGTGG + Intergenic
933371906 2:81425181-81425203 GGGCAGGCTTGGAGGCTCTGTGG + Intergenic
935619500 2:105116665-105116687 GACCAGGCCTGGGAGGTCAGAGG - Intergenic
935673665 2:105576200-105576222 GGGCAGGCTTGGCAGCCCGGGGG + Intergenic
936577257 2:113667491-113667513 GGTCAGTTCTGGGAGCTCTGTGG + Intergenic
937239920 2:120453373-120453395 GGTGAGGGTTGGGGACTCAGAGG - Intergenic
937818051 2:126275509-126275531 GGTCAGTATCTGGAGCTCAGTGG - Intergenic
938381828 2:130840652-130840674 GGACAGGTTTGGGATCCCAGTGG + Intronic
939135069 2:138283977-138283999 GGCCAGGCTTGGGCACTCTGTGG - Intergenic
941878417 2:170458683-170458705 GGGCTGGCTTTGGAGCTCCGTGG + Intronic
942218955 2:173750576-173750598 GGCCAGGTTTGGGGGCACAGTGG - Intergenic
942368944 2:175260141-175260163 GGTCTGGCTTGGGAGCGGAAGGG - Intergenic
945147363 2:206752562-206752584 AGTCAGGGTTTGGAGCTCATAGG + Intronic
946171035 2:217895703-217895725 GGTCAGGAATGGGACCCCAGTGG - Intronic
946268445 2:218568797-218568819 GGTCAGGGGTGAGAGGTCAGAGG + Exonic
948385142 2:237576263-237576285 GAGCTGGCTGGGGAGCTCAGTGG - Intronic
948677150 2:239603290-239603312 GGTGAGGTGTGGGAGCTCCGGGG - Intergenic
948717479 2:239874658-239874680 GGGCAGGTCTGAGAGCTCAGGGG - Intergenic
948858861 2:240743303-240743325 AGGCAGGACTGGGAGCTCAGGGG - Intronic
1169020524 20:2327682-2327704 GGTCAGGCTTGGGAGCTCAGAGG + Intronic
1169219276 20:3812066-3812088 GGTCGGGATTGGGAGCACTGGGG + Intergenic
1170571691 20:17636420-17636442 GGTCAGGTTTAGGAGTCCAGGGG - Intronic
1172122410 20:32606241-32606263 TGTGTGGCTTTGGAGCTCAGGGG - Intronic
1172392346 20:34574473-34574495 GGACAGGCTTCCCAGCTCAGGGG + Intronic
1173790888 20:45827165-45827187 GGCCAGGCCTGGGTGCTCTGTGG - Intronic
1175206094 20:57312435-57312457 GGTCTGGCGTGGGAGATCACAGG + Intergenic
1175385574 20:58592852-58592874 GGACAGGCTTGGGAGCCAGGGGG + Intergenic
1176240055 20:64071759-64071781 GGTCACCTGTGGGAGCTCAGTGG + Intronic
1176623874 21:9075174-9075196 CGTCAAGATTGGGAGGTCAGCGG + Intergenic
1179439378 21:41382476-41382498 GGTCAGGTCTGGAACCTCAGGGG - Exonic
1182352078 22:29704803-29704825 GCTCAGGGTTGGGAGGGCAGTGG + Intergenic
1183372003 22:37438106-37438128 GTTCAGGCTGGGGAGGTCGGGGG - Intergenic
1183442119 22:37829200-37829222 GGGCAGGATAGAGAGCTCAGTGG - Intergenic
1183442127 22:37829242-37829264 GGGCAGGATAGAGAGCTCAGTGG - Intergenic
1183457287 22:37929784-37929806 GATGAGCCTTGGGAGCTCAGAGG - Intronic
1183527455 22:38332103-38332125 GATCAGGCTTGGGAACATAGGGG + Intronic
1184423353 22:44394852-44394874 GATCAGGGTTGGGAGCTCCACGG - Intergenic
1184678278 22:46054973-46054995 GTTTGGGCATGGGAGCTCAGAGG + Intronic
1184692085 22:46122041-46122063 GCTCAGGGCTGGGAGCTCCGAGG + Intergenic
1185291914 22:50031514-50031536 GGGCAGGCCTGGGCCCTCAGCGG + Intronic
1185422971 22:50745173-50745195 GGTCAGTTCTGGGAGCTCTGTGG - Exonic
950483934 3:13261648-13261670 GCTCTGCCCTGGGAGCTCAGGGG - Intergenic
950545722 3:13636931-13636953 GGTCTGGCTCAGGATCTCAGGGG + Intronic
953598371 3:44338592-44338614 ATTCAGGGTTGGGGGCTCAGAGG + Exonic
954214494 3:49116891-49116913 AGGCAGGTTTGGGAGTTCAGCGG + Exonic
954697209 3:52434250-52434272 TCTCAGGCTGGGGAGCACAGAGG - Exonic
955494797 3:59520093-59520115 AATCAGTCTTGGGAGCTCAGAGG - Intergenic
956094473 3:65701613-65701635 GGTCTGTCTTGGAAGCTCAAGGG - Intronic
959832427 3:110880541-110880563 GGTCACTTTTGGGAACTCAGAGG + Intergenic
961320233 3:126068073-126068095 GGTCACGCTTTGGCTCTCAGGGG + Exonic
961373868 3:126449706-126449728 GGTCGGCCTTGGCAGCCCAGTGG - Intronic
961772603 3:129260908-129260930 GGTCAGCCTTGAGGACTCAGAGG + Intronic
965802029 3:172504575-172504597 GGTCATGCTTTGGCTCTCAGCGG + Intergenic
968262388 3:197335639-197335661 GATCAGGCTGGGGAGCACAGAGG - Intergenic
968940936 4:3637284-3637306 GGAAAGGCTTGGGATCTCATGGG + Intergenic
969517340 4:7654934-7654956 AGTGAGGCTGGGGTGCTCAGGGG - Intronic
971160851 4:24132626-24132648 GGTCAGTTTTGGGAGAGCAGAGG - Intergenic
975126566 4:70788934-70788956 GTTCATGCTTGAGAGCTCTGAGG - Exonic
975689542 4:76950087-76950109 GGTCGGGGTTAGGAGCCCAGGGG + Intronic
977427467 4:96886465-96886487 TGTCAGGCTCGGCAGATCAGAGG + Intergenic
978612664 4:110560924-110560946 GGTAGGGCTTTGGAGGTCAGAGG + Intronic
984981740 4:185288823-185288845 GGTCTGGCTTTGCAGCTCAGAGG + Intronic
985859022 5:2455676-2455698 TGACAGTCTCGGGAGCTCAGTGG + Intergenic
986738513 5:10684972-10684994 AGACAGGCTGGTGAGCTCAGGGG - Intronic
989173644 5:38498450-38498472 TGTAAGGCTCTGGAGCTCAGGGG - Intronic
990617149 5:57519718-57519740 GGTAAGGATTAGGAGTTCAGAGG - Intergenic
991546766 5:67790821-67790843 GGCCTGGCTGGGGAGCTCATAGG + Intergenic
992073333 5:73168848-73168870 GGTCATGATTGGCAGCTCAGGGG + Intergenic
992219098 5:74554442-74554464 GTTCAGGCATGGGAGCACATTGG - Intergenic
1000192362 5:158923864-158923886 GGTTTGGCTTTTGAGCTCAGAGG - Intronic
1000746203 5:165037117-165037139 GTTCAAGATTGTGAGCTCAGGGG - Intergenic
1001958022 5:175861656-175861678 AGTCAGGCAGGGGAGCACAGCGG + Intronic
1002454926 5:179340405-179340427 GAGCAGGCCTGGGAGCTGAGTGG - Intronic
1002714711 5:181219725-181219747 GGTCAGCCTTGGGCGCTCGGAGG - Intergenic
1002915090 6:1522638-1522660 GCTCTGGCTTGGGGGTTCAGGGG - Intergenic
1006902803 6:37513864-37513886 GGGGAGGCTCGGGAGATCAGAGG - Intergenic
1007377968 6:41469328-41469350 AGTCAGGCTGGGGAGCGGAGGGG - Intergenic
1007719438 6:43876478-43876500 GGGCAGGCCTGGGACCACAGAGG - Intergenic
1011688836 6:89846758-89846780 CTTCAGACTTGGGAGCTCAAGGG + Intronic
1013614032 6:111824965-111824987 GCTCAGAGATGGGAGCTCAGAGG - Intronic
1016049235 6:139513221-139513243 GGTCAGGCTTGGCAAAGCAGGGG + Intergenic
1017057528 6:150451667-150451689 GGTGAGTCTGGGGAGCACAGTGG + Intergenic
1018632763 6:165834964-165834986 GCCAGGGCTTGGGAGCTCAGGGG + Intronic
1019637245 7:2082430-2082452 AGCCGGGCCTGGGAGCTCAGCGG + Intronic
1020330906 7:7016022-7016044 GGGCAAGCTTGGGAGCTATGAGG + Intergenic
1021684025 7:23164116-23164138 AGTCAGTCTTGTCAGCTCAGTGG - Intronic
1022792586 7:33703604-33703626 GGGCAGGCAGGGGATCTCAGAGG + Intergenic
1023148997 7:37182070-37182092 GATCAGGCTTGGAAGGTAAGAGG + Intronic
1028229778 7:88292697-88292719 GGTTAGGGTTGGTAGTTCAGAGG - Intronic
1029361844 7:100093693-100093715 TGTCATGCTGGGGAGCCCAGTGG - Intronic
1030737404 7:113066214-113066236 GGACAAGCTCAGGAGCTCAGTGG - Intergenic
1032708261 7:134440841-134440863 GCTGAGGCTGTGGAGCTCAGTGG - Intergenic
1034492038 7:151397947-151397969 GGTCAGGCCTGTGAGCTTTGGGG - Intronic
1034952052 7:155305223-155305245 GGTTAGGCTTAGAACCTCAGAGG - Intronic
1035176710 7:157056961-157056983 GGACAGGACTGGGACCTCAGGGG - Intergenic
1035715910 8:1754789-1754811 GGGAAGGCTTGGTGGCTCAGTGG + Intergenic
1039473316 8:37826878-37826900 GGTCAGGGTTGGGGGCTGAGGGG - Intronic
1048427519 8:134336660-134336682 GGACAGCAGTGGGAGCTCAGTGG - Intergenic
1048461088 8:134622646-134622668 GGTCAGCCTTGGGAGCTGGGTGG - Intronic
1048815954 8:138333886-138333908 GGTCAGGATCAGGAGGTCAGTGG - Intronic
1048993331 8:139774147-139774169 GGGCAGGCGTGGGAGCTTCGTGG - Intronic
1049171349 8:141163007-141163029 GTTCAGGGTGGGGAGCCCAGAGG - Intronic
1049245460 8:141560034-141560056 TCCCAGGCTTGGGAGGTCAGGGG + Intergenic
1049790315 8:144469383-144469405 TGACAGGCTTGGGAGCCTAGCGG + Intronic
1053418479 9:37961788-37961810 GTGCAGACTTTGGAGCTCAGAGG - Intronic
1057234291 9:93346392-93346414 GCGCAGGATTCGGAGCTCAGAGG - Exonic
1057240491 9:93404048-93404070 GGTCAGTCTTGGGTCCTGAGGGG + Intergenic
1057307786 9:93922088-93922110 TGCCGGGCTTGGGTGCTCAGGGG - Intergenic
1057858024 9:98617234-98617256 GCTCTGGGTTGGGTGCTCAGGGG + Intronic
1058077766 9:100668026-100668048 GCTCTGGCTTGGGAGCTCCTAGG - Intergenic
1058754739 9:108073932-108073954 ACCCAGGCTGGGGAGCTCAGAGG - Intergenic
1058936242 9:109772086-109772108 GGCCAGATTTGGGAGCTCATGGG + Intronic
1061034919 9:128108074-128108096 GGGCATGCTTGGGAGTGCAGGGG + Exonic
1062063873 9:134515448-134515470 GGTAGGGCATGGGAGCTGAGAGG - Intergenic
1062067891 9:134538616-134538638 GGTCAGCCTTGGGAGACCTGGGG - Intergenic
1187391026 X:18886792-18886814 GGGGAGGCCTGGGAGCACAGAGG - Intergenic
1187491375 X:19754821-19754843 GATCAGGCTTAGGAGCAGAGGGG + Intronic
1190263828 X:48815956-48815978 TGTCAGGATTGGGAGCACAGGGG - Exonic
1191896074 X:65994750-65994772 TGTCAGACTTGAGAGCACAGGGG + Intergenic
1192069494 X:67922054-67922076 GGTCAGGGTAGGGAACTTAGAGG + Intergenic
1192796214 X:74425697-74425719 GGTTAGGGTTGGGAGTTCAGAGG + Intronic
1193895368 X:87109257-87109279 CGTCTGCCTTGTGAGCTCAGTGG - Intergenic
1195324322 X:103745992-103746014 GCTCAGGCTGGGGAGTGCAGTGG - Intergenic
1197971138 X:132116319-132116341 GGTCATTCTTTGGAGCTCAGTGG - Intronic
1198772107 X:140141307-140141329 AGTGATGCTTGGCAGCTCAGGGG + Intergenic
1199542876 X:148977028-148977050 AGTCAGGCATGCCAGCTCAGTGG + Intronic
1200119289 X:153782890-153782912 GGCCAGGCTGGGCAGCCCAGTGG - Intronic