ID: 1169021329

View in Genome Browser
Species Human (GRCh38)
Location 20:2333311-2333333
Sequence CAATATATGAAGCAACTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 109}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169021327_1169021329 21 Left 1169021327 20:2333267-2333289 CCCTAGCAATCTGTCTTCTGGCA 0: 1
1: 0
2: 1
3: 25
4: 162
Right 1169021329 20:2333311-2333333 CAATATATGAAGCAACTGCCTGG 0: 1
1: 0
2: 0
3: 12
4: 109
1169021326_1169021329 22 Left 1169021326 20:2333266-2333288 CCCCTAGCAATCTGTCTTCTGGC 0: 1
1: 0
2: 2
3: 11
4: 155
Right 1169021329 20:2333311-2333333 CAATATATGAAGCAACTGCCTGG 0: 1
1: 0
2: 0
3: 12
4: 109
1169021328_1169021329 20 Left 1169021328 20:2333268-2333290 CCTAGCAATCTGTCTTCTGGCAG 0: 1
1: 0
2: 3
3: 32
4: 368
Right 1169021329 20:2333311-2333333 CAATATATGAAGCAACTGCCTGG 0: 1
1: 0
2: 0
3: 12
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169021329 Original CRISPR CAATATATGAAGCAACTGCC TGG Intronic
906401139 1:45505600-45505622 CAGTATTTTAAGAAACTGCCTGG + Intronic
907959089 1:59261648-59261670 AAATACATGAAGGAAGTGCCTGG - Intergenic
909817814 1:80018549-80018571 CATTTTATAAAGCAACTGCTCGG + Intergenic
919835464 1:201570265-201570287 CCAAAGATCAAGCAACTGCCAGG + Intergenic
920010761 1:202865855-202865877 AAATATATGAACAAACTGCCTGG - Intergenic
920720708 1:208384214-208384236 CTATCCATGAAGCAGCTGCCTGG + Intergenic
921285791 1:213608170-213608192 CAAGAGATAAAGCACCTGCCTGG + Intergenic
924446570 1:244138304-244138326 CAAAATATGAACCAACTCACCGG - Intergenic
1063529349 10:6816077-6816099 CAATATGTGTAACAACAGCCTGG - Intergenic
1064379704 10:14830372-14830394 CAATACCTGAAGCCACTGCAGGG + Intronic
1067405204 10:46016388-46016410 CAGTATATCAGGCAACTGACGGG + Intronic
1067994175 10:51251220-51251242 CAATTTATGAAACAGGTGCCTGG - Intronic
1068242748 10:54325451-54325473 CAATATAAAAAACCACTGCCAGG + Intronic
1071236086 10:83650323-83650345 TAATATATGTAGCAACTTCATGG + Intergenic
1073147559 10:101290986-101291008 CATTACCTGAAGAAACTGCCTGG - Intergenic
1074596115 10:114868517-114868539 CAATATATTGAGGAACTGACAGG + Intronic
1076746797 10:132518534-132518556 CAATACATGAAGCTACTTTCAGG - Intergenic
1077709200 11:4518970-4518992 TAATACATGAAGCAACTCCAAGG - Intergenic
1078888948 11:15536337-15536359 CAATGTAGGAAACAACTACCAGG + Intergenic
1080373695 11:31682484-31682506 CAATTTATGATGCAACTGTCAGG - Intronic
1081008632 11:37780073-37780095 CAATATCTGAAGAAACTATCTGG - Intergenic
1084812705 11:71624456-71624478 CATTGTATGAAGGAACTGCAGGG - Intergenic
1092153225 12:6265575-6265597 AAATATATGAAGAAGCGGCCGGG + Intergenic
1092535584 12:9383708-9383730 AAATAAATAAAGCAACTACCTGG - Intergenic
1092752748 12:11734067-11734089 CAATAGAAGTAGCCACTGCCAGG - Intronic
1093592171 12:20916040-20916062 CAATATATAAAACAAGTGCTGGG - Exonic
1095417354 12:41991132-41991154 CAGTAAATGAATCACCTGCCTGG + Intergenic
1101760727 12:107656724-107656746 TAATATACAAAGCAAGTGCCAGG + Intronic
1104236603 12:126944334-126944356 TAATATAGAAAGCAAATGCCTGG + Intergenic
1109401671 13:61838987-61839009 CAAAATATGAAGCAAATATCAGG + Intergenic
1110212736 13:72992345-72992367 AAATTAATGAAGCATCTGCCAGG + Intronic
1112039680 13:95534297-95534319 AACCATATGAAGCTACTGCCAGG + Intronic
1112968610 13:105230748-105230770 GAAAAGATGAAGCAGCTGCCAGG - Intergenic
1115432418 14:33335265-33335287 CACTATAAGAATAAACTGCCTGG - Intronic
1116919269 14:50555578-50555600 CAAAATATGAAGGAACTGGCTGG - Intronic
1116998289 14:51346938-51346960 CATTCTCTGAAGCAACAGCCTGG - Intergenic
1117595763 14:57325830-57325852 GAATTCAAGAAGCAACTGCCTGG + Intergenic
1118190328 14:63574346-63574368 CAATATATGATGCAATGGCCGGG - Intergenic
1119069130 14:71563850-71563872 CAGTATAAGAAGAAAATGCCTGG - Intronic
1125061723 15:35434008-35434030 CAATATATAAATCAACTGTCAGG + Intronic
1125383091 15:39108231-39108253 GAATATATGAAATAACTGGCTGG + Intergenic
1126528461 15:49685381-49685403 CAATATAGGAAACTCCTGCCAGG + Intergenic
1128303698 15:66583601-66583623 GAAGATATGAAGAAATTGCCTGG - Intronic
1129500332 15:76030620-76030642 CAATCTATGAAACTACTGCAAGG + Intronic
1131231385 15:90662270-90662292 CAATATAGGAAGGAACTTCATGG - Intergenic
1134886028 16:17792351-17792373 CAAAATATGAATCAACTCCAGGG + Intergenic
1138165909 16:54801407-54801429 CAATAAATGAAACGATTGCCAGG + Intergenic
1138282556 16:55783242-55783264 CTTTATCAGAAGCAACTGCCAGG + Intergenic
1138286384 16:55813377-55813399 CTTTATCAGAAGCAACTGCCAGG - Intronic
1139027575 16:62837377-62837399 CAATATGTGACGCATCAGCCGGG - Intergenic
1144528791 17:16015893-16015915 CAATTTATGAAGGACCTTCCTGG + Intronic
1146605237 17:34252198-34252220 AAAGATCTGAAGCCACTGCCTGG - Intergenic
1150986020 17:70197891-70197913 CCATGAATGAAGCAACTGCCAGG + Intergenic
1151950925 17:77353344-77353366 CAAGATATGAAGCTAGTACCAGG + Intronic
1156921088 18:42523110-42523132 CAATAAATAAAACAACTGTCAGG - Intergenic
1164266653 19:23625045-23625067 CAAGATATGATTCAATTGCCTGG + Intronic
1166091761 19:40513805-40513827 CAGAATACGAAGCAAATGCCTGG + Intronic
925471369 2:4164868-4164890 CAGCAGATGAAGAAACTGCCCGG - Intergenic
928739568 2:34334367-34334389 GAATATCTGAAGCAAGTGCCTGG - Intergenic
929784095 2:44976573-44976595 CAAGACACGAAGCAACTGCCTGG + Intergenic
932557816 2:72841107-72841129 CCATTTATGAAGCACCTGCTGGG + Intergenic
936712232 2:115144464-115144486 AAATATAAGAAGCATCTGCTTGG + Intronic
936799149 2:116245132-116245154 AAATATATGAAGCCATTTCCTGG - Intergenic
939615066 2:144353256-144353278 CAAGAGATTAAGAAACTGCCAGG - Intergenic
944768486 2:202888568-202888590 TAATATATCAAGCAAATGACAGG + Intronic
944819027 2:203410192-203410214 CAATATTTGTAGCAATTCCCTGG - Intronic
945906856 2:215603767-215603789 CAATATATCAGGAAACTGACCGG - Intergenic
946112245 2:217430194-217430216 GAATGTATGAAGCAAGGGCCTGG + Intronic
948677366 2:239605694-239605716 CAATATATGCATGAACTGGCTGG - Intergenic
948810131 2:240470646-240470668 CAAAATATGCAGCATCGGCCTGG + Intergenic
1169021329 20:2333311-2333333 CAATATATGAAGCAACTGCCTGG + Intronic
1170896131 20:20416156-20416178 CTATATATGAAGCATCTACCTGG + Intronic
1173402292 20:42736426-42736448 GCATAAATGAAGCAACTGCAGGG - Intronic
1175635971 20:60583979-60584001 TAATAGATGATGCAAATGCCTGG - Intergenic
1177377221 21:20286798-20286820 CAATCTAGGAAGCAATTGACTGG + Intergenic
1178676929 21:34638970-34638992 CAAGATGTGAAGCCTCTGCCTGG - Intergenic
1179103046 21:38373474-38373496 AAATATACAAACCAACTGCCTGG + Intergenic
1179674281 21:42971530-42971552 CAATATATGTATAAGCTGCCGGG + Intergenic
1182063380 22:27413646-27413668 CAATATAAGAAGCCACTGTAAGG + Intergenic
949899487 3:8798470-8798492 CATTATTTGATGCAAGTGCCAGG + Intronic
953720716 3:45352496-45352518 CCATTTATTAAGCACCTGCCTGG + Intergenic
959870448 3:111321314-111321336 CTATATTTGAAGCTTCTGCCGGG - Intronic
964829653 3:160869881-160869903 CAATGCCTGAAGCAAATGCCAGG - Intronic
968720937 4:2203812-2203834 TGATAAATGAAGCAAATGCCAGG + Intronic
971381416 4:26101889-26101911 CAATATACGAAGCACCTACAGGG + Intergenic
976011134 4:80490083-80490105 TAATATCTGAAGCAGCTGGCTGG - Intronic
978431141 4:108634615-108634637 CAAAATATAAAGCAGATGCCGGG + Intergenic
979811827 4:125045968-125045990 TAAAATATGAGGCAACTGCAGGG + Intergenic
986269928 5:6221249-6221271 CAATCTATGAGGAACCTGCCTGG + Intergenic
988408305 5:30852926-30852948 AAATATATGTAAGAACTGCCAGG - Intergenic
989667907 5:43877891-43877913 CAATAACTAAACCAACTGCCAGG - Intergenic
998439151 5:142141818-142141840 CAATTTATTAAACACCTGCCAGG - Intronic
999788090 5:154910597-154910619 AAATATATTAAGCAACTGCTGGG - Intronic
1005579220 6:27217668-27217690 AAATAAATGAAGAAACTGTCTGG - Intergenic
1010990646 6:82476104-82476126 AAATATTTGGAGAAACTGCCTGG + Intergenic
1017401542 6:154070000-154070022 CTATAGCTGAAGCAACTTCCAGG - Intronic
1024788714 7:52938043-52938065 CAATATTTGAACAAACAGCCAGG - Intergenic
1032560243 7:132883360-132883382 TAATATATGAAACAACTGAGAGG + Intronic
1039478268 8:37853007-37853029 CCAAATCTGAGGCAACTGCCAGG - Intergenic
1040513203 8:48113496-48113518 AAATATATGTAGCATCGGCCAGG - Intergenic
1041710287 8:60888173-60888195 AACTATATGAAGCCTCTGCCAGG - Intergenic
1041745457 8:61203928-61203950 ATATTTATGAAGCAACTGCTAGG + Intronic
1041943616 8:63417134-63417156 CAACATATTAAGGAACTGCCAGG - Intergenic
1042656191 8:71099970-71099992 CATTAGAGGAAGCAACTGCACGG + Intergenic
1044368620 8:91381358-91381380 AAATATATGAATGAACTGCATGG + Intronic
1044575639 8:93766412-93766434 CAAAATAAGAAACAACTGGCTGG - Intronic
1051328760 9:16001160-16001182 CAAGATAGGAACCAACTGACAGG + Intronic
1051487686 9:17626202-17626224 CAATAAAAGAAGCAGGTGCCAGG - Intronic
1052557676 9:30038469-30038491 CCACATCTGAAGCAACTGCCTGG - Intergenic
1056469395 9:86890604-86890626 AAAAATATTAAGCAACTGGCTGG - Intergenic
1060860215 9:126947864-126947886 AAATATATGTAGCTACTGCAGGG + Intronic
1186897233 X:14016090-14016112 CTATATTAGAAGCAGCTGCCAGG - Intronic
1187654964 X:21461644-21461666 CAACCTATGAAACTACTGCCAGG - Intronic
1187817497 X:23248646-23248668 CAATATATGTAGCAATAGCATGG + Intergenic
1188181111 X:27057221-27057243 AAAGATATGAAGCAACGGCTGGG + Intergenic
1194232510 X:91341668-91341690 GAATATATGAACAAACTGCTTGG + Intergenic
1197807809 X:130414292-130414314 CAAAAGAAGAAGGAACTGCCAGG - Intergenic
1197874278 X:131087213-131087235 CATTATCTGAAGCATCTGCGTGG - Intronic
1200706879 Y:6450567-6450589 CATTATGTGAAGCACCTGCTGGG + Intergenic
1200913596 Y:8552201-8552223 CATGATATTAAGCATCTGCCAGG - Intergenic
1201027233 Y:9714141-9714163 CATTATGTGAAGCACCTGCTGGG - Intergenic
1201412459 Y:13713847-13713869 GAACATATGAAGCAATTGCAAGG + Intergenic