ID: 1169022133

View in Genome Browser
Species Human (GRCh38)
Location 20:2338133-2338155
Sequence TCAGTACCAGGTTAGATAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 85}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169022133_1169022137 -4 Left 1169022133 20:2338133-2338155 CCCATTATCTAACCTGGTACTGA 0: 1
1: 0
2: 0
3: 7
4: 85
Right 1169022137 20:2338152-2338174 CTGACTGGCAATTAGCACTGAGG 0: 1
1: 0
2: 0
3: 8
4: 116
1169022133_1169022138 17 Left 1169022133 20:2338133-2338155 CCCATTATCTAACCTGGTACTGA 0: 1
1: 0
2: 0
3: 7
4: 85
Right 1169022138 20:2338173-2338195 GGACCTTAGACCACAAAACCAGG 0: 1
1: 0
2: 1
3: 2
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169022133 Original CRISPR TCAGTACCAGGTTAGATAAT GGG (reversed) Intronic
901690746 1:10971612-10971634 ACAGGACCAGGGTAGAGAATGGG - Intronic
908718615 1:67097989-67098011 TTAGTTCCAGGTTAGCCAATTGG - Intronic
909728621 1:78867088-78867110 CCAGTCACAGGTTTGATAATTGG + Intergenic
911084906 1:93968243-93968265 CCAGCACCAGGTTCAATAATTGG + Intergenic
911731167 1:101293802-101293824 TCAAGACCAGGTTAGATTCTGGG - Intergenic
911809760 1:102261016-102261038 TCAGTACCAGAATAGATATTGGG - Intergenic
922606934 1:226895277-226895299 GCAGGACCAGGGAAGATAATGGG + Intronic
1063871911 10:10426384-10426406 TCAGTACCAGGCCAGTAAATGGG - Intergenic
1064126747 10:12668508-12668530 TGAGTATCAGTTTCGATAATGGG + Intronic
1066098948 10:32099753-32099775 GCAGGACCAGGTGAGGTAATTGG - Intergenic
1067936805 10:50619827-50619849 TCAGTAGCAGGTTTGATTTTGGG - Intronic
1070005519 10:72420533-72420555 TTAGTGCCAGGTTAGATTCTTGG + Intronic
1072265017 10:93719119-93719141 TCAGCACCAGGATAGCTACTAGG + Intergenic
1079353226 11:19710986-19711008 TAAATAACAGGTTAAATAATGGG + Intronic
1083526698 11:63373614-63373636 ACAGAAACAGGTTAGATAATGGG - Intronic
1095154141 12:38832385-38832407 GCAGTCCCAGTTTAGCTAATTGG - Intronic
1095279219 12:40330631-40330653 TATGTACCAGGTTAGGTGATGGG + Intronic
1096293912 12:50367179-50367201 CCAATACCAGGTTAGATAGATGG - Intronic
1098607052 12:72403830-72403852 GCATTACCAGGTCAGATTATGGG + Intronic
1103669784 12:122603920-122603942 TCAGGAACTGGTTAGAAAATAGG + Intronic
1107691268 13:42955968-42955990 TCGGTACCATGTTAGATGCTGGG + Intronic
1111204124 13:84981826-84981848 TAAGTACCAGGCTAAATAATGGG - Intergenic
1117812812 14:59566506-59566528 TCAGTAGGTGGTCAGATAATGGG + Intronic
1125199276 15:37086328-37086350 TCAGCACCAGTTTAGCTGATAGG - Intronic
1126667968 15:51092359-51092381 TCAGATACAGGTTAGATAACAGG - Intronic
1129496171 15:75983470-75983492 TCAGTACAATATTAAATAATAGG - Intronic
1135396965 16:22138756-22138778 TCAGTACCAGGGTAGGGAAAAGG - Intronic
1138378711 16:56585286-56585308 TCAGTCCCAGGATAGTAAATTGG + Intergenic
1138390588 16:56667686-56667708 TCAGAGTCAGGTTAGAGAATTGG + Intronic
1138391069 16:56670171-56670193 TCAGAGCCTGGTTAGAGAATTGG - Intronic
1140648882 16:77065280-77065302 GCAGCACTAGGTTAGATATTGGG + Intergenic
1145304621 17:21666517-21666539 GCAGTTCCAGGATAGAAAATAGG - Intergenic
928161997 2:28936313-28936335 TCAGCAGCATGTTAGATAAATGG - Intronic
928763121 2:34608010-34608032 TCAGTACTATGTTGAATAATGGG + Intergenic
931289121 2:60856879-60856901 CCAGGCCCAGGTTAGATAATTGG + Intergenic
931890402 2:66665237-66665259 TCTGTACCAGATTGGATAAATGG + Intergenic
932042541 2:68316848-68316870 TCAGAACTGGTTTAGATAATTGG - Intronic
935337038 2:102025849-102025871 ACACTACAGGGTTAGATAATGGG - Intronic
941600013 2:167530918-167530940 TCAGTACAAGGGTACATAATAGG + Intergenic
946691184 2:222309499-222309521 TCAGTACAAGGTCACATGATAGG + Intergenic
1169022133 20:2338133-2338155 TCAGTACCAGGTTAGATAATGGG - Intronic
1171522132 20:25783956-25783978 GCAGTTCCAGGATAGAAAATAGG - Intronic
1171529882 20:25845901-25845923 GCAGTTCCAGGATAGAAAATAGG - Intronic
1171554695 20:26071927-26071949 GCAGTTCCAGGATAGAAAATAGG + Intergenic
1177991216 21:28038332-28038354 TCAGTGCCAGAATACATAATTGG - Intergenic
949800578 3:7899343-7899365 TCAGTACTATGTTAGATAGGAGG - Intergenic
954216671 3:49128631-49128653 TCAGCCCCAGATTAGATAACAGG + Intronic
955935756 3:64100940-64100962 TCAGTAGCAGGGGTGATAATGGG - Intronic
956780134 3:72597058-72597080 TCAGGACCAGATGAGAAAATGGG + Intergenic
959450363 3:106491596-106491618 GCAGTTGCAGGTTAGTTAATGGG - Intergenic
959509513 3:107194968-107194990 ACAGTAGCAGATTAGAGAATGGG + Intergenic
963739442 3:149061483-149061505 TCAATACCAGGTTTAATATTTGG + Intronic
973230028 4:47830266-47830288 TGAGTACCAGATTAATTAATTGG + Intronic
973924213 4:55720579-55720601 TCAGCTCCAGGTAAGATAAATGG - Intergenic
975026397 4:69554220-69554242 CCAGTACCATGTTAAATAAGAGG - Intergenic
977931977 4:102759587-102759609 TAAGTACCAGGTCAGAAATTTGG + Intronic
979470114 4:121085757-121085779 CCAGTACTAGGTTAAATAAAAGG - Intergenic
981823157 4:148909308-148909330 TTAGTCCCAGGTTGGATAATTGG - Intergenic
983063461 4:163183950-163183972 TCAGTGCCTGGCTAGATTATGGG + Intergenic
987062929 5:14259495-14259517 TCAGTAGGAGGGTAAATAATAGG + Intronic
990409664 5:55528472-55528494 CCAGTACCATGTTAGGTACTAGG - Intronic
994628494 5:102251625-102251647 TAAACACCAGGTTAGATATTAGG - Intronic
995102571 5:108331423-108331445 TCTGTAACAGCTTAGTTAATTGG - Intronic
995366850 5:111371540-111371562 TCAGCCCCATGTTAAATAATTGG - Intronic
999023272 5:148194573-148194595 AAAGGTCCAGGTTAGATAATGGG - Intergenic
1002768483 6:265891-265913 TCTGTTCCAGGTTAGGAAATGGG + Intergenic
1003134885 6:3427469-3427491 TCAGCACCAGATTAGAAAGTGGG + Intronic
1004624507 6:17362233-17362255 TCAGTGTCAGCTTAGATCATGGG + Intergenic
1005450191 6:25964551-25964573 TCAGTACAAAATGAGATAATAGG + Intronic
1006938059 6:37732283-37732305 TCAGTACCAGGTTTGGAAAAAGG + Intergenic
1013138450 6:107305956-107305978 GAGGTACCAGGTTAGATGATGGG - Intronic
1015991318 6:138946635-138946657 TAAGTACCAGTTTAGTTTATTGG - Intronic
1019958474 7:4436242-4436264 TCAGCACCTGATTAGAAAATGGG - Intergenic
1021237711 7:18163318-18163340 TCACAACCATGTTTGATAATTGG + Intronic
1025282627 7:57639131-57639153 GCAGTTCCAGGATAGAAAATAGG - Intergenic
1025302096 7:57826286-57826308 GCAGTTCCAGGATAGAAAATAGG + Intergenic
1027689449 7:81324438-81324460 TAAGTACCAGGGTAGATTAATGG + Intergenic
1029843437 7:103389582-103389604 TCAGGACCTGGTTAGCTAAAAGG + Intronic
1030582385 7:111374284-111374306 TCAGTACTAGGAAAGATAAAAGG - Intronic
1030966610 7:116000407-116000429 CCAGTACCATGTTGAATAATAGG - Intronic
1031129486 7:117815530-117815552 AAAGTTCCTGGTTAGATAATTGG - Intronic
1034885452 7:154795042-154795064 TCCGCCCCAGGTTAGATAAAAGG - Intronic
1037516448 8:19636474-19636496 TCAGCACCACTTTATATAATTGG + Intronic
1044723378 8:95171759-95171781 TCAGTCCCATGATAGGTAATAGG + Intergenic
1045567094 8:103330717-103330739 TCAGTACCATGTAAGAAACTGGG - Intronic
1056709870 9:88983720-88983742 TCAGTACAATGTTAAATATTGGG - Intergenic
1058553752 9:106143834-106143856 TGAGTACCAGTTGAGAGAATAGG - Intergenic
1059228380 9:112694341-112694363 TCATTATCATGTTAGAGAATAGG - Intronic
1062727015 9:138080139-138080161 TCAGTACAAGGGTAGAAAAGTGG + Intronic
1191095894 X:56672596-56672618 CCAGTGCCAGAATAGATAATTGG - Intergenic
1191925271 X:66302312-66302334 TAAGTTCAAGGTTAGATGATGGG + Intergenic
1193405737 X:81099118-81099140 TTAGTTCCAGGTTATATAATGGG - Intergenic
1200403900 Y:2789534-2789556 TCATTACCAATTAAGATAATAGG - Intergenic