ID: 1169022133

View in Genome Browser
Species Human (GRCh38)
Location 20:2338133-2338155
Sequence TCAGTACCAGGTTAGATAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169022133_1169022137 -4 Left 1169022133 20:2338133-2338155 CCCATTATCTAACCTGGTACTGA No data
Right 1169022137 20:2338152-2338174 CTGACTGGCAATTAGCACTGAGG No data
1169022133_1169022138 17 Left 1169022133 20:2338133-2338155 CCCATTATCTAACCTGGTACTGA No data
Right 1169022138 20:2338173-2338195 GGACCTTAGACCACAAAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169022133 Original CRISPR TCAGTACCAGGTTAGATAAT GGG (reversed) Intronic