ID: 1169035411 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 20:2447125-2447147 |
| Sequence | TGGGCTACTTAGAACTTTGT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1169035411_1169035420 | 29 | Left | 1169035411 | 20:2447125-2447147 | CCTACAAAGTTCTAAGTAGCCCA | No data | ||
| Right | 1169035420 | 20:2447177-2447199 | AATTTGCATGTAATTGTAAGTGG | No data | ||||
| 1169035411_1169035421 | 30 | Left | 1169035411 | 20:2447125-2447147 | CCTACAAAGTTCTAAGTAGCCCA | No data | ||
| Right | 1169035421 | 20:2447178-2447200 | ATTTGCATGTAATTGTAAGTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1169035411 | Original CRISPR | TGGGCTACTTAGAACTTTGT AGG (reversed) | Intergenic | ||