ID: 1169035412

View in Genome Browser
Species Human (GRCh38)
Location 20:2447144-2447166
Sequence TTGATGCAAATTGAGGGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169035412_1169035420 10 Left 1169035412 20:2447144-2447166 CCCACACCCTCAATTTGCATCAA No data
Right 1169035420 20:2447177-2447199 AATTTGCATGTAATTGTAAGTGG No data
1169035412_1169035421 11 Left 1169035412 20:2447144-2447166 CCCACACCCTCAATTTGCATCAA No data
Right 1169035421 20:2447178-2447200 ATTTGCATGTAATTGTAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169035412 Original CRISPR TTGATGCAAATTGAGGGTGT GGG (reversed) Intergenic
No off target data available for this crispr