ID: 1169035413

View in Genome Browser
Species Human (GRCh38)
Location 20:2447145-2447167
Sequence GTTGATGCAAATTGAGGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169035413_1169035420 9 Left 1169035413 20:2447145-2447167 CCACACCCTCAATTTGCATCAAC No data
Right 1169035420 20:2447177-2447199 AATTTGCATGTAATTGTAAGTGG No data
1169035413_1169035421 10 Left 1169035413 20:2447145-2447167 CCACACCCTCAATTTGCATCAAC No data
Right 1169035421 20:2447178-2447200 ATTTGCATGTAATTGTAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169035413 Original CRISPR GTTGATGCAAATTGAGGGTG TGG (reversed) Intergenic
No off target data available for this crispr