ID: 1169035415

View in Genome Browser
Species Human (GRCh38)
Location 20:2447151-2447173
Sequence GGGCAGGTTGATGCAAATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169035415_1169035420 3 Left 1169035415 20:2447151-2447173 CCTCAATTTGCATCAACCTGCCC No data
Right 1169035420 20:2447177-2447199 AATTTGCATGTAATTGTAAGTGG No data
1169035415_1169035421 4 Left 1169035415 20:2447151-2447173 CCTCAATTTGCATCAACCTGCCC No data
Right 1169035421 20:2447178-2447200 ATTTGCATGTAATTGTAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169035415 Original CRISPR GGGCAGGTTGATGCAAATTG AGG (reversed) Intergenic