ID: 1169035420

View in Genome Browser
Species Human (GRCh38)
Location 20:2447177-2447199
Sequence AATTTGCATGTAATTGTAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169035414_1169035420 4 Left 1169035414 20:2447150-2447172 CCCTCAATTTGCATCAACCTGCC No data
Right 1169035420 20:2447177-2447199 AATTTGCATGTAATTGTAAGTGG No data
1169035412_1169035420 10 Left 1169035412 20:2447144-2447166 CCCACACCCTCAATTTGCATCAA No data
Right 1169035420 20:2447177-2447199 AATTTGCATGTAATTGTAAGTGG No data
1169035415_1169035420 3 Left 1169035415 20:2447151-2447173 CCTCAATTTGCATCAACCTGCCC No data
Right 1169035420 20:2447177-2447199 AATTTGCATGTAATTGTAAGTGG No data
1169035411_1169035420 29 Left 1169035411 20:2447125-2447147 CCTACAAAGTTCTAAGTAGCCCA No data
Right 1169035420 20:2447177-2447199 AATTTGCATGTAATTGTAAGTGG No data
1169035413_1169035420 9 Left 1169035413 20:2447145-2447167 CCACACCCTCAATTTGCATCAAC No data
Right 1169035420 20:2447177-2447199 AATTTGCATGTAATTGTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169035420 Original CRISPR AATTTGCATGTAATTGTAAG TGG Intergenic
No off target data available for this crispr