ID: 1169041105

View in Genome Browser
Species Human (GRCh38)
Location 20:2496300-2496322
Sequence ACCAGCCCATTGAAGGTCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 108}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169041105 Original CRISPR ACCAGCCCATTGAAGGTCCT AGG Intronic
904389625 1:30173723-30173745 AGCAGCCCATGGCAGGGCCTGGG - Intergenic
905773008 1:40650256-40650278 CCCAGCCCAGTGAAGGCCCATGG - Intronic
907583654 1:55594900-55594922 ACCAGCCAAGGGAATGTCCTGGG + Intergenic
907923313 1:58932994-58933016 ACCAGCCCAGTCCAGTTCCTGGG - Intergenic
911096682 1:94060887-94060909 TCCAGCCCATTAAATGTCCAGGG - Intronic
913202706 1:116508866-116508888 AGCAGCCCATTGCACATCCTTGG + Intergenic
916786868 1:168092883-168092905 ACGAGACCCTTGAAGCTCCTGGG - Intronic
923007113 1:230058880-230058902 GACAGCCCATTGTGGGTCCTGGG + Intronic
923658017 1:235935210-235935232 ACCAGCCCATGATAGGTTCTTGG + Intergenic
924560004 1:245150501-245150523 ACCAACCCATTTAAGGGCCCTGG + Intergenic
1069716830 10:70526527-70526549 ACCAGGCTGTTGAAGGGCCTTGG + Intronic
1071297008 10:84228593-84228615 ACTTGCCCATTGAAGTTGCTGGG - Intergenic
1075564717 10:123494976-123494998 TCCTGCCCATGGATGGTCCTTGG + Intergenic
1075844710 10:125535867-125535889 AACAGCCCATTGGAGGTCACTGG - Intergenic
1076135775 10:128045083-128045105 ACCTGCCCCTTGAAGGCCATTGG + Intronic
1076338377 10:129725902-129725924 ACCAGCCCCTTCTAGCTCCTGGG + Intronic
1081534390 11:43986618-43986640 ACCAGCCCAGTAAAGTTCCAGGG - Intergenic
1083421793 11:62557435-62557457 ACCAGCCCATTGTATGTACCTGG + Intergenic
1084419738 11:69054330-69054352 ACCACCCCATTCTAGGTCCCGGG + Intronic
1085358354 11:75861153-75861175 AACAGATAATTGAAGGTCCTTGG - Intronic
1089280923 11:117373811-117373833 ACCAGGCCATGGAAGGACTTGGG - Exonic
1092515495 12:9207398-9207420 TCCAGGCCATTTAAGGTCCCTGG - Intronic
1095518785 12:43037359-43037381 AGCATCCCACTGAAGGTTCTAGG - Intergenic
1098180677 12:67843246-67843268 ACGAGCACATTGTAGGTACTTGG + Intergenic
1101965686 12:109280405-109280427 ACCTTCCCACTGAATGTCCTTGG + Intronic
1114798092 14:25739762-25739784 ACCAGCCCATGGAAGCAGCTGGG - Intergenic
1117966622 14:61213117-61213139 ACCAGCACATTTAAATTCCTTGG + Intronic
1119928790 14:78523982-78524004 AACAGCCCAATCAATGTCCTGGG + Intronic
1122069588 14:99196965-99196987 ACCAGAACATGGAAGGTTCTTGG - Intronic
1122608793 14:102966824-102966846 ACCAACCCACTGAAGGACTTGGG - Intronic
1126793782 15:52243749-52243771 GCCAGCCCACTGAAGGACCACGG - Intronic
1128455974 15:67831640-67831662 ACTAGCCCATAGATGGTCTTGGG + Intronic
1128745920 15:70114039-70114061 ACCAGGCCACTGAAGGACTTGGG - Intergenic
1129900424 15:79144027-79144049 ACCAGCCCATTAAAGCAGCTGGG - Intergenic
1133811755 16:9166220-9166242 ACTCGCCGATGGAAGGTCCTGGG - Intergenic
1138593633 16:58017329-58017351 TCAAGCCCAATAAAGGTCCTGGG - Exonic
1139974988 16:70802526-70802548 GCCAACACATTGAGGGTCCTTGG + Intergenic
1142857105 17:2737225-2737247 ACCTGCCCCTGGAATGTCCTGGG + Intergenic
1145998432 17:29117607-29117629 CCCAGCCCCTAGAAAGTCCTGGG + Intronic
1147424292 17:40338448-40338470 TCCTGCCCATGGAAGGCCCTTGG - Intronic
1147505406 17:41011696-41011718 GCCAGGTCATTGAAGGTCTTGGG + Intronic
1160218810 18:76957416-76957438 ACCAGCCCCTGGAGGGACCTGGG - Intronic
1166321548 19:42022143-42022165 ACCGGCCCATCTGAGGTCCTGGG + Intronic
926774938 2:16412665-16412687 ACCAGCCTGTTGAAGGACTTTGG - Intergenic
937062292 2:118989598-118989620 ACCAGCACACTGCAGGTGCTTGG + Intronic
937138025 2:119572052-119572074 ACCAGCCCAATTCAGGACCTTGG - Intronic
939997371 2:148932484-148932506 ACCACCACACAGAAGGTCCTGGG + Intronic
941285719 2:163610376-163610398 TCCAGTCCACTGGAGGTCCTTGG + Exonic
946621302 2:221566649-221566671 TCCAGCCCATTAAAAGTACTGGG + Intronic
947546576 2:231014833-231014855 AAGAGCCCACTGAAGGTCCTTGG - Intronic
947835746 2:233174022-233174044 CTCATCCCATGGAAGGTCCTCGG + Intronic
1168908502 20:1426332-1426354 AGCAGCCCATGGAAAGACCTTGG - Intergenic
1169041105 20:2496300-2496322 ACCAGCCCATTGAAGGTCCTAGG + Intronic
1169901180 20:10553024-10553046 ACAGGCCCATTGAAGTTCCAAGG - Intronic
1170079053 20:12451043-12451065 ACCAGCCCATGGAAGCAGCTAGG + Intergenic
1172602956 20:36196206-36196228 ACCAACTCTTTGAAGGTCTTGGG + Intronic
1178432791 21:32531287-32531309 ACCAACTGATGGAAGGTCCTGGG - Intergenic
1181512372 22:23394676-23394698 ACCAGCCCCTCGAAGGGCCTGGG - Intergenic
949090295 3:19281-19303 ACAAGACCATTGAAAGGCCTGGG - Intergenic
949765018 3:7516608-7516630 GCCAGATCACTGAAGGTCCTTGG + Intronic
950452688 3:13074023-13074045 CCCGGCACATGGAAGGTCCTCGG - Intergenic
950532696 3:13561769-13561791 GCCAGCCCACTGCAGGTGCTGGG - Intronic
951223434 3:20093866-20093888 TCCAGCCCAGAGAAGTTCCTGGG + Intronic
953707635 3:45243288-45243310 ACCAGCACATTGAAAGACTTAGG - Intergenic
954287136 3:49626919-49626941 CCCACCTCATTGAAGGTCCTGGG - Intronic
961924455 3:130462836-130462858 ACCAGCTCACTTAAGGCCCTGGG - Intronic
962810951 3:138959248-138959270 ACCATGCCATTGCAGGTGCTGGG + Intergenic
967717732 3:192782476-192782498 AGCAGCTCATTGAAGATCCCAGG - Intergenic
967975587 3:195032771-195032793 ACCAGCCCAATGCAGGTGATGGG + Intergenic
968253728 3:197246834-197246856 ACCATCCCATTGAGGGTCTTGGG + Intronic
968706518 4:2080808-2080830 CTCAGCCCATGGAAGGCCCTGGG - Intronic
971502182 4:27329333-27329355 ACTAGCACATGGAAGGTACTTGG + Intergenic
974065102 4:57070139-57070161 ACCAGCCCTCTGTAGGTCCTGGG + Intronic
975215054 4:71743601-71743623 ACCAACTCATTGCAGTTCCTGGG - Intronic
978366330 4:107986932-107986954 ACCAACCCAATGTAGGCCCTTGG - Intergenic
980686942 4:136240894-136240916 ACCAGCCCTATGACTGTCCTGGG - Intergenic
983105386 4:163680118-163680140 ACCAGATCATGGAAGATCCTTGG - Intronic
989635741 5:43530970-43530992 ACCAGACCTTTGAGGGTCCCAGG - Intronic
994794063 5:104270959-104270981 AACAGGACATTCAAGGTCCTCGG - Intergenic
995382564 5:111550862-111550884 ACTGGCCCACTGAAGTTCCTGGG + Intergenic
995598068 5:113768098-113768120 ACCAGCCCATTAAAGCAGCTGGG + Intergenic
998729242 5:145054922-145054944 ACCAGCACATAGTAGGTGCTCGG - Intergenic
998996839 5:147875194-147875216 ACAAGCCCAATAAAGGTCGTTGG + Intronic
999879855 5:155850274-155850296 ACCAGCCCAGTAAGGGCCCTTGG - Intergenic
1001144309 5:169170431-169170453 AGCAGCCAATTGTTGGTCCTGGG + Intronic
1001929472 5:175662531-175662553 ACCAGTGCTTTGAAGGCCCTTGG - Intronic
1002804313 6:557753-557775 ACCAGCCCTTTGAAGGAACAGGG + Intronic
1003539362 6:7004676-7004698 ACCAGCCCAGCAATGGTCCTGGG - Intergenic
1006301623 6:33196458-33196480 ACCAGGGCGTTGAGGGTCCTGGG - Exonic
1007088468 6:39167130-39167152 CCCAGCCCATAGCAGGTGCTTGG - Intergenic
1010636006 6:78260170-78260192 ACCAGCCCATTAAAGCAGCTGGG - Intergenic
1013671127 6:112404423-112404445 ACTTGCGCATTGAAGGCCCTCGG - Intergenic
1015642097 6:135346130-135346152 AAAGGCCCAGTGAAGGTCCTGGG + Intronic
1018567766 6:165173871-165173893 AACATACCATTGAAGGACCTCGG + Intergenic
1022033917 7:26516547-26516569 ACCAGCCAGTTGATGTTCCTGGG + Intergenic
1023054524 7:36280766-36280788 AGCAGCGGATTGAAGGTCCCAGG - Intronic
1023905851 7:44521193-44521215 ACAATCCCATCAAAGGTCCTGGG + Intronic
1024849771 7:53697906-53697928 ACCAGCTCAGAGAAGGTCCTCGG + Intergenic
1025752520 7:64306206-64306228 ACCAACCCATTTAAGGGGCTAGG - Intergenic
1030145214 7:106346090-106346112 ATCAGCCTATAGAAGCTCCTTGG - Intergenic
1034432726 7:151049196-151049218 CCCAGCCCAGTGCAGGTCGTTGG - Exonic
1035475300 7:159139614-159139636 ACCAGGCCATGGAAAGTGCTAGG - Intronic
1037825699 8:22159478-22159500 ACCAACCAAGTGAAGGTCTTGGG - Intronic
1042146008 8:65731031-65731053 ACCAGCACATGGTAGGTACTTGG - Intronic
1046063390 8:109166286-109166308 ACCACTGCATTGAAGGTACTGGG - Intergenic
1047483035 8:125302483-125302505 CCCAGGCCATTGAAGGACTTTGG + Intronic
1049718345 8:144104176-144104198 GGCAGCCCATTGGAGGTCCCGGG - Exonic
1053294603 9:36903673-36903695 ACCAGGCCTTAGCAGGTCCTGGG - Intronic
1054970812 9:71084104-71084126 ATTAGCACATTGTAGGTCCTTGG - Intronic
1058658727 9:107249238-107249260 AGCATCCCATTCGAGGTCCTGGG + Intergenic
1061321929 9:129836050-129836072 ACCAGACCCGTGAAGGTCCAGGG - Intronic
1189401559 X:40674133-40674155 ACTAGCCCTTTGAAGATGCTGGG - Intronic
1191910770 X:66147096-66147118 GCCTGCCCATTGATGGTTCTAGG + Intergenic
1196943393 X:120799597-120799619 CCCAGCCCAGTGAAGGACCAAGG - Intergenic
1198704033 X:139427913-139427935 ACCAGCACAATGAAGATCCATGG - Intergenic