ID: 1169042803

View in Genome Browser
Species Human (GRCh38)
Location 20:2509546-2509568
Sequence GAACCGGGATCTTAGATAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 47}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169042803_1169042810 5 Left 1169042803 20:2509546-2509568 CCTCTTATCTAAGATCCCGGTTC 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1169042810 20:2509574-2509596 TGGGCTACTAGAGCCGGGCGTGG 0: 1
1: 0
2: 1
3: 5
4: 106
1169042803_1169042809 0 Left 1169042803 20:2509546-2509568 CCTCTTATCTAAGATCCCGGTTC 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1169042809 20:2509569-2509591 AGATCTGGGCTACTAGAGCCGGG 0: 1
1: 0
2: 0
3: 18
4: 174
1169042803_1169042814 20 Left 1169042803 20:2509546-2509568 CCTCTTATCTAAGATCCCGGTTC 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1169042814 20:2509589-2509611 GGGCGTGGTGGCGCGCGCCTGGG 0: 1
1: 11
2: 29
3: 140
4: 475
1169042803_1169042811 8 Left 1169042803 20:2509546-2509568 CCTCTTATCTAAGATCCCGGTTC 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1169042811 20:2509577-2509599 GCTACTAGAGCCGGGCGTGGTGG 0: 1
1: 0
2: 5
3: 97
4: 607
1169042803_1169042813 19 Left 1169042803 20:2509546-2509568 CCTCTTATCTAAGATCCCGGTTC 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1169042813 20:2509588-2509610 CGGGCGTGGTGGCGCGCGCCTGG 0: 2
1: 30
2: 155
3: 597
4: 1700
1169042803_1169042808 -1 Left 1169042803 20:2509546-2509568 CCTCTTATCTAAGATCCCGGTTC 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1169042808 20:2509568-2509590 CAGATCTGGGCTACTAGAGCCGG 0: 1
1: 0
2: 0
3: 6
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169042803 Original CRISPR GAACCGGGATCTTAGATAAG AGG (reversed) Intronic
901882444 1:12202157-12202179 GCACCGGGAGCTCAGGTAAGAGG + Exonic
918170093 1:181988348-181988370 GAACTGGGATCTTAGAGCTGGGG - Intergenic
1062898505 10:1123476-1123498 GTCCAGGGATCTTAGATGAGGGG + Intronic
1066429650 10:35339092-35339114 GAACTGGGATCTGGGATGAGAGG - Intronic
1079472975 11:20797613-20797635 GAATCGAGATCCTAGATAAGAGG + Intronic
1083558083 11:63648443-63648465 CAACTGGGAGCTTTGATAAGAGG - Intronic
1090667791 11:128926318-128926340 GAACCAGGTTCTTGGACAAGAGG + Intergenic
1101762125 12:107667431-107667453 GAACAGGCTTCATAGATAAGAGG + Intergenic
1101870440 12:108561268-108561290 AAACTGGGAACTTAGATAACAGG + Exonic
1113941698 13:114021759-114021781 GACCCAGGCTCTTAGATAGGAGG + Intronic
1114423014 14:22600345-22600367 AAACCTGGATTTGAGATAAGGGG + Intronic
1115164244 14:30430136-30430158 GTGATGGGATCTTAGATAAGAGG - Intergenic
1125099985 15:35901461-35901483 AATCAGGGATCTTAGAGAAGTGG - Intergenic
1136171469 16:28492241-28492263 GAGCCGTGACCTTAGATCAGTGG + Intronic
1138384540 16:56627166-56627188 GAACCGGGATTTTAGAGACCAGG + Intergenic
1160220755 18:76975908-76975930 GAAGCGGGAACTTAGCTGAGAGG + Intergenic
931432973 2:62223675-62223697 GAAACAGGATTTCAGATAAGAGG - Exonic
933590187 2:84224376-84224398 GAGCCTGGCTCTTAGATATGTGG - Intergenic
1169042803 20:2509546-2509568 GAACCGGGATCTTAGATAAGAGG - Intronic
1173326391 20:42037439-42037461 GAAAGGGGATCTTAAATGAGAGG - Intergenic
1180200831 21:46223073-46223095 GAACCAGCATTTTAGATCAGTGG + Intronic
1182084307 22:27550961-27550983 GAACTGGGATCCTGGATAAATGG - Intergenic
963341367 3:144038211-144038233 GAACCTTGATATTACATAAGCGG - Intronic
981588955 4:146335456-146335478 GAACCTGAATCTTTTATAAGAGG + Intronic
981681121 4:147399314-147399336 GAACAGGCATTTTAGATAAATGG - Intergenic
988459907 5:31425645-31425667 GGACTGGGAGCTTAGGTAAGAGG - Intronic
989713337 5:44428159-44428181 GAACCTGGATCTTAGTTGAAAGG - Intergenic
990601475 5:57362751-57362773 GAACAAGGATCTTACATAAGAGG - Intergenic
993518326 5:88865244-88865266 GAACAGTTAGCTTAGATAAGTGG - Intronic
994184823 5:96805943-96805965 GTACCGGGACCTTGGATCAGAGG + Intronic
1001079475 5:168656565-168656587 GAACCTGAATCTTAGAGAAAAGG - Intergenic
1001264918 5:170267227-170267249 GAACAGGGAGCTCAGATAGGAGG - Intronic
1021063295 7:16141021-16141043 GAAACGAGATCTTAGACAAGTGG - Intronic
1023405413 7:39828799-39828821 GAACAAGGATTTTAGAAAAGAGG + Intergenic
1029299613 7:99569117-99569139 GAACCAGGATCCTAAATAATTGG - Intronic
1036175487 8:6534023-6534045 GAGCTGGGAGCTTAGAGAAGTGG - Intronic
1037046917 8:14317692-14317714 GAGCCAGGCTCCTAGATAAGGGG + Intronic
1039742599 8:40396159-40396181 GGACAGGGATCTCAGCTAAGAGG + Intergenic
1039866492 8:41508829-41508851 GAGCTGAGATCTTAGAGAAGGGG + Intronic
1039900989 8:41752458-41752480 GAGCCTGGAACTCAGATAAGAGG - Intronic
1048417766 8:134245660-134245682 AGGCCGGGAACTTAGATAAGGGG - Intergenic
1053616871 9:39776259-39776281 GAACAGGGGTTTTAGTTAAGGGG + Intergenic
1053875051 9:42535595-42535617 GAACAGGGGTTTTAGTTAAGGGG + Intergenic
1053897585 9:42759015-42759037 GAACAGGGGTTTTAGTTAAGGGG - Intergenic
1054236646 9:62566124-62566146 GAACAGGGGTTTTAGTTAAGGGG - Intergenic
1054267297 9:62931179-62931201 GAACAGGGGTTTTAGTTAAGGGG - Intergenic
1054550785 9:66600632-66600654 GAACAGGGGTTTTAGTTAAGGGG - Intergenic
1188779372 X:34261495-34261517 GAGCAGGGATATTAGAGAAGAGG + Intergenic
1190533180 X:51400668-51400690 GAACTGGGAGCTTAAATAAATGG + Intergenic
1192012368 X:67288748-67288770 GAATCATGCTCTTAGATAAGTGG + Intergenic
1196474027 X:116061599-116061621 GAACTGGGACCTTAGCTGAGGGG + Intergenic