ID: 1169043338

View in Genome Browser
Species Human (GRCh38)
Location 20:2515016-2515038
Sequence AAGAAGAAGAAGAAAGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8938
Summary {0: 16, 1: 101, 2: 331, 3: 1363, 4: 7127}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169043337_1169043338 18 Left 1169043337 20:2514975-2514997 CCTGGGTGACAGAGCGAGACATT 0: 11
1: 795
2: 15190
3: 78376
4: 157635
Right 1169043338 20:2515016-2515038 AAGAAGAAGAAGAAAGAAGAAGG 0: 16
1: 101
2: 331
3: 1363
4: 7127
1169043336_1169043338 22 Left 1169043336 20:2514971-2514993 CCAGCCTGGGTGACAGAGCGAGA 0: 20256
1: 110872
2: 156495
3: 163124
4: 142023
Right 1169043338 20:2515016-2515038 AAGAAGAAGAAGAAAGAAGAAGG 0: 16
1: 101
2: 331
3: 1363
4: 7127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169043338 Original CRISPR AAGAAGAAGAAGAAAGAAGA AGG Intronic
Too many off-targets to display for this crispr