ID: 1169044432

View in Genome Browser
Species Human (GRCh38)
Location 20:2524669-2524691
Sequence GGCCTCCAGATCCTCTGCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 119}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169044432_1169044434 -4 Left 1169044432 20:2524669-2524691 CCTTCGCAGAGGATCTGGAGGCC 0: 1
1: 0
2: 0
3: 5
4: 119
Right 1169044434 20:2524688-2524710 GGCCTTTCAGAAAGGAAGCCAGG 0: 1
1: 1
2: 2
3: 17
4: 260
1169044432_1169044439 19 Left 1169044432 20:2524669-2524691 CCTTCGCAGAGGATCTGGAGGCC 0: 1
1: 0
2: 0
3: 5
4: 119
Right 1169044439 20:2524711-2524733 TGCAGGGACGACCCGAAGCCCGG No data
1169044432_1169044437 3 Left 1169044432 20:2524669-2524691 CCTTCGCAGAGGATCTGGAGGCC 0: 1
1: 0
2: 0
3: 5
4: 119
Right 1169044437 20:2524695-2524717 CAGAAAGGAAGCCAGGTGCAGGG 0: 1
1: 1
2: 5
3: 54
4: 490
1169044432_1169044436 2 Left 1169044432 20:2524669-2524691 CCTTCGCAGAGGATCTGGAGGCC 0: 1
1: 0
2: 0
3: 5
4: 119
Right 1169044436 20:2524694-2524716 TCAGAAAGGAAGCCAGGTGCAGG 0: 1
1: 0
2: 2
3: 42
4: 366

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169044432 Original CRISPR GGCCTCCAGATCCTCTGCGA AGG (reversed) Intronic
900391457 1:2435762-2435784 GGGGTCCAGAGCCCCTGCGATGG + Intronic
904855042 1:33491457-33491479 GGCCTCCAGCTCCTCATAGAAGG - Exonic
904894748 1:33806211-33806233 AGCCTCCAGATCCTCCCAGAGGG - Intronic
905015155 1:34773001-34773023 TGCCTCCAGATGCCCTGCTATGG - Intronic
907091642 1:51730211-51730233 GGCCTCCAGTTCCACCGAGAGGG + Intronic
910130578 1:83900446-83900468 GGACTCCAGATGCTTTGTGAAGG + Intronic
912571934 1:110631142-110631164 GCACTCCAGGTACTCTGCGAAGG - Intronic
916659067 1:166904333-166904355 GGCCTGCAGATCCACTGGCAGGG - Intergenic
917926513 1:179793764-179793786 GGCCTCCAGATCCTGTGGCAGGG - Intronic
919528102 1:198679615-198679637 GGCCTCCAGATCCATTGCTGAGG + Intronic
919977644 1:202623213-202623235 GGACTCCAGCTCCTCTCCCATGG - Intronic
921661286 1:217806214-217806236 GCTCTCCAGTTCCTCTGGGATGG + Intronic
923340381 1:233001640-233001662 GGCCTCCATGTCCTCTTCAAAGG - Exonic
923628766 1:235635911-235635933 GGCCTTCAGAGCCACTGCAAGGG - Intronic
1069616784 10:69811345-69811367 AGGCTGCAGATGCTCTGCGAAGG + Intronic
1069751293 10:70746901-70746923 GGCCTGCACGTCCTCTGCAAAGG - Intronic
1071407409 10:85351483-85351505 GGCCTCCAGACACTCAGGGAAGG - Intergenic
1074931500 10:118131291-118131313 GGCCTGCAGCACCTCTGAGAGGG - Intergenic
1076545255 10:131240879-131240901 GGCGTGCAGGTCCCCTGCGAGGG + Intronic
1077036950 11:499865-499887 GGCCTGCAGCTGCTCTGCGAAGG - Exonic
1077414473 11:2418345-2418367 GCCCTGGAGATCCTCTGAGACGG + Exonic
1084469550 11:69349005-69349027 GGCCTCCAGTTCCACGGAGAAGG - Intronic
1084957288 11:72698071-72698093 GGCCAGCAGATCCTCGGCTAGGG + Exonic
1085460222 11:76689038-76689060 AGCCTCCAGAGCCTCTGGGGAGG - Intergenic
1086067099 11:82757119-82757141 GCCCTCCAGGTCCTCTGAGAGGG - Intergenic
1096460595 12:51819827-51819849 GGCCTCCAGAGCTCCTGCAAAGG + Intergenic
1096744072 12:53714146-53714168 GGCCTCCTCATCCTCTGTGGTGG + Exonic
1096878280 12:54647146-54647168 GGCCTCTGGATCATCTGCAAAGG + Exonic
1098569045 12:71968505-71968527 GGCCTCCAGACACTCTCCCAGGG + Intronic
1098904162 12:76144679-76144701 GGCCTACAGCTTCTCTGTGATGG - Intergenic
1102050055 12:109855725-109855747 TTCCTCCAGAGCATCTGCGACGG - Exonic
1108688745 13:52844773-52844795 TGCCTCGGGATCCTCTGCGCAGG - Exonic
1119165342 14:72487881-72487903 GGCCTTCAGATTCTATGAGAAGG - Intronic
1122172089 14:99885051-99885073 GGCCTCCAGAGCCTAAGGGAGGG - Intronic
1122199958 14:100116473-100116495 AGCCCCCAGCTCCTCTGGGATGG - Intronic
1122630356 14:103104769-103104791 GGCCTCCAGCTCCGCGGAGATGG - Exonic
1129199257 15:73989066-73989088 GGCCCCCAGTTCCTCTGTCAAGG + Intronic
1129348097 15:74937545-74937567 GGCCTGCAGCGCCTCGGCGAAGG - Intronic
1129780099 15:78264453-78264475 GGCCGCCGGAACCTCCGCGAAGG + Intronic
1129822941 15:78617045-78617067 GGCTTCCAGATCTTCTGTGCAGG + Exonic
1132893139 16:2214373-2214395 GGCCTCCAGCTCCGCGGCCAGGG + Exonic
1139386821 16:66578378-66578400 GACCTCCAGAGCCGCTGAGAAGG - Intronic
1140757266 16:78079082-78079104 GCCCTCCAGAACCTTTGCTATGG - Intergenic
1141176722 16:81725294-81725316 GGCTTTCAGATCCACTGGGAAGG + Intergenic
1145119841 17:20248237-20248259 ACCTTCCAGATCCTCTGAGAAGG + Intronic
1145775426 17:27524575-27524597 GGCCTCCAGTATCTCTGCAAAGG + Intronic
1152268913 17:79312445-79312467 GGCCACCAGATGCACTGTGAGGG + Intronic
1152595092 17:81234017-81234039 GGCCCCCAGATCCTCTGCACGGG - Exonic
1152900727 17:82939596-82939618 GGTCTCCACATCCTCTGCTTAGG + Intronic
1154464721 18:14632407-14632429 TGCCTCCATTTCCTCTGCAAAGG + Intergenic
1155130649 18:22931370-22931392 GGCTTCCAGTTACTCTGTGAAGG - Intronic
1160023956 18:75204172-75204194 GGCGGCCAGCCCCTCTGCGACGG + Intronic
1160443511 18:78911356-78911378 GCCCTCCAGCTCCTATCCGAGGG + Intergenic
1161728487 19:5944652-5944674 GGCCTCCAAATGCTCTGTGCAGG + Intronic
1161960265 19:7519439-7519461 GGGGTCCAGATCCTCCGAGACGG - Exonic
1163441583 19:17324742-17324764 GGCTTCCAGCTCCTCAGCCAGGG + Exonic
1163776858 19:19224066-19224088 GGCCTCCTGGGCCTCAGCGAAGG - Exonic
1166357755 19:42237098-42237120 GGCTTCCAGCTCCTGTGGGAGGG - Intronic
1167030620 19:46957357-46957379 GGCCTCCAGAAGCACTGGGATGG - Intronic
925098457 2:1226259-1226281 GTCCTCCAGGTCCTCTTCCAGGG - Intronic
934608989 2:95720678-95720700 GGCTCCCAGATCCTCTGAAAAGG + Intergenic
938934187 2:136114933-136114955 AGCCTCAAGATCCTCTCCAAAGG - Exonic
947596786 2:231417931-231417953 GGTCTCCAGAGACTCTGGGAAGG - Intergenic
947629778 2:231644645-231644667 GCCCTGCACATGCTCTGCGAGGG + Intergenic
948488662 2:238297417-238297439 GGCCTCTGAATCCTCTGAGAAGG + Intergenic
948930184 2:241127015-241127037 GGCCCCCAGCCCCTCTGGGATGG - Exonic
1169018409 20:2310336-2310358 GCCCTCCAGATCTTCTCCCAGGG + Exonic
1169022437 20:2340040-2340062 GCCCTCCAGATCCCCTGGGTGGG + Intronic
1169044432 20:2524669-2524691 GGCCTCCAGATCCTCTGCGAAGG - Intronic
1169738795 20:8867339-8867361 GGACTCCAGGTTCTCTGAGATGG + Intronic
1171448551 20:25221096-25221118 GGCTTCCAGGTCCACTGGGAAGG - Intronic
1172981349 20:38944614-38944636 GGTGTCCAGATCCTCTGCAGGGG + Intronic
1176809816 21:13525976-13525998 TGCCTCCATTTCCTCTGCAAAGG - Intergenic
1177717671 21:24860783-24860805 GGCCTCCAGCTCCCATGCAAAGG - Intergenic
1178066018 21:28905179-28905201 GGTCTCCAGTTGCTCTGCAAGGG - Intergenic
1179540269 21:42079258-42079280 GGCCTCCCTATCTTCTGGGAGGG - Intronic
1179571247 21:42280076-42280098 GGCCTCCAGGTCCTGTGGGGAGG - Intronic
1180990471 22:19932731-19932753 CGGCTCCAGATGCTCTGGGAGGG - Intronic
950692645 3:14672278-14672300 CCCCTGCAGGTCCTCTGCGATGG + Exonic
953793905 3:45968275-45968297 GGCCTCAAGCTCCTGTGCCAAGG + Exonic
954451215 3:50572688-50572710 GGCCACCAGATTCTCTGGGCTGG - Intronic
954751616 3:52817270-52817292 GGCCCCTAAATCCTCGGCGACGG + Intronic
960130722 3:114053290-114053312 GGCCACCATATCCTCTCCCAAGG + Intronic
968078454 3:195830026-195830048 GCCCTCCAGCTCCTCTGGGCCGG + Intergenic
969326862 4:6449050-6449072 GGCCTCCAGAACCTGTCAGAAGG + Intronic
975290053 4:72667134-72667156 GGACTCCAGATCCTGTGTGGTGG + Intergenic
975363100 4:73494768-73494790 GGCTTCCAAATCCTCTGTCAAGG - Intronic
975854226 4:78606132-78606154 AGCCTGCAAGTCCTCTGCGAAGG - Intronic
976842648 4:89449850-89449872 GGCCTACAGATTATCTGTGAGGG - Intergenic
981653420 4:147084893-147084915 GGCCATCAGATGCTCTGCAATGG - Intergenic
983092666 4:163523167-163523189 TGCCTCCTGATCTTCTGGGAAGG + Intergenic
985713369 5:1442523-1442545 GGCCTCCACATGCTTTGCAAAGG + Intronic
986278231 5:6300720-6300742 GGCCTGCAGATGCCCTGCCATGG - Intergenic
997665103 5:135624254-135624276 TGCCTCTAGATGCTCTGGGACGG - Intergenic
997671015 5:135671987-135672009 GACCTCCAATTCCTCTGGGAAGG - Intergenic
998321249 5:141234651-141234673 GACCTCCATTTCCTCTGCTATGG - Intergenic
1000285360 5:159821699-159821721 GGCCTCCTGACCCTGTGCCAGGG - Intergenic
1001252816 5:170160985-170161007 ATCCTGCAGATCCTCTGCAAAGG - Intergenic
1002159650 5:177307690-177307712 CACCTCCAGCTCCTCTGCGCGGG + Exonic
1004604186 6:17178380-17178402 TGGCTCCAGAGCCTCTGAGATGG - Intergenic
1006456764 6:34136477-34136499 GGCTTCCAGATCCTTCGTGAGGG + Intronic
1008535822 6:52505519-52505541 TGCCTCCAGACCTTCTGCAAGGG + Intronic
1013350106 6:109297977-109297999 GGCCTCCTTATCCTTTGCAAAGG - Intergenic
1013681613 6:112530254-112530276 GGCCTCCAAATCCTCACTGATGG - Intergenic
1017566592 6:155693717-155693739 TGTCTCCAGATGCTCTGCAAAGG + Intergenic
1017626212 6:156351711-156351733 AGCCCCCAGCTCCTCTGCCAGGG - Intergenic
1019155905 6:170038798-170038820 TCCATCCAGATCCTCTGGGATGG - Intergenic
1020125727 7:5531577-5531599 GGCCTCCAGATGGTCTGGGAGGG - Intronic
1022471244 7:30682910-30682932 AGCCTCCATAGCCTCTGGGAAGG + Intronic
1025481842 7:60992521-60992543 GGCCCTCAGAGCCTCTGCGGCGG - Intergenic
1030184954 7:106752476-106752498 GGCCTGCTGATCCTCTGCTTGGG - Intergenic
1032117229 7:129127323-129127345 GGCCTCCAGCTCCTTGGCGTCGG - Intergenic
1033670520 7:143488641-143488663 GGTCTCCATATCCTATGGGATGG - Intergenic
1035637204 8:1155985-1156007 GGCCCACAGGCCCTCTGCGACGG - Intergenic
1038577423 8:28717144-28717166 GCCCTCCATTTCCTCTTCGAAGG - Exonic
1041711827 8:60901281-60901303 GGGCTCCTGACCCTCTGCAATGG + Intergenic
1048164863 8:132053633-132053655 TCCTTCCAGATCCTCTGAGAAGG - Intronic
1049790742 8:144471677-144471699 GGACTCCAGAGCCTCTGCATAGG + Intronic
1055829464 9:80360756-80360778 GGCCACCAGCTCCCCTGCGCAGG + Intergenic
1189198480 X:39171481-39171503 GGGCTCAAGATCCTCTTCCAAGG - Intergenic
1192777076 X:74256265-74256287 GGCCTCCAGCTCCTGGGCCATGG + Intergenic
1196009363 X:110870744-110870766 GGCCTCCAGCTGCCCTGTGAGGG - Intergenic
1196862277 X:120039573-120039595 GACCTCCATAGTCTCTGCGAAGG + Intergenic
1196880825 X:120196771-120196793 GACCTCCATAGTCTCTGCGAAGG - Intergenic
1197971331 X:132118498-132118520 GGCCTCCAGTTCCTGTGTGGTGG - Intronic